Transcript: Mouse XM_006521446.3

PREDICTED: Mus musculus cytohesin 4 (Cyth4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyth4 (72318)
Length:
2805
CDS:
183..1355

Additional Resources:

NCBI RefSeq record:
XM_006521446.3
NBCI Gene record:
Cyth4 (72318)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009816 CGGGAGAAAGAAATTCAACAT pLKO.1 374 CDS 100% 4.950 6.930 N Cyth4 n/a
2 TRCN0000380083 GGGAGATCAGGTGACTGAATG pLKO_005 1850 3UTR 100% 10.800 8.640 N Cyth4 n/a
3 TRCN0000381367 ACCTCACTCACACCTTCTTTA pLKO_005 928 CDS 100% 13.200 9.240 N Cyth4 n/a
4 TRCN0000009817 CCTCACTCACACCTTCTTTAA pLKO.1 929 CDS 100% 13.200 9.240 N Cyth4 n/a
5 TRCN0000380741 AGCAGCTACGGAACCTGTTTG pLKO_005 859 CDS 100% 10.800 7.560 N Cyth4 n/a
6 TRCN0000381742 GGAGCTACAGCAGATCAAATG pLKO_005 224 CDS 100% 10.800 7.560 N Cyth4 n/a
7 TRCN0000379779 TCCCTTACATTGGGAAGTATC pLKO_005 1678 3UTR 100% 10.800 7.560 N Cyth4 n/a
8 TRCN0000242590 TGCAGATGTGTTTGCCCAAAT pLKO_005 293 CDS 100% 10.800 7.560 N CYTH4 n/a
9 TRCN0000379615 TGCAGATGTGTTTGCCCAAAT pLKO_005 293 CDS 100% 10.800 7.560 N Cyth4 n/a
10 TRCN0000380980 TTGAGTTCACCACTGACAAAG pLKO_005 1045 CDS 100% 10.800 7.560 N Cyth4 n/a
11 TRCN0000009815 GCCCAAATCGACTGCTTTGAA pLKO.1 306 CDS 100% 5.625 3.938 N Cyth4 n/a
12 TRCN0000381037 TGCTGTCCTTCTCCGTCATCA pLKO_005 733 CDS 100% 4.950 3.465 N Cyth4 n/a
13 TRCN0000382346 AGCGCTTTGTGACCATGAATC pLKO_005 805 CDS 100% 10.800 6.480 N Cyth4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11846 pDONR223 100% 24.7% 25.6% None (many diffs) n/a
2 ccsbBroad304_11846 pLX_304 0% 24.7% 25.6% V5 (many diffs) n/a
3 TRCN0000478838 GGCCGAAATTAGCAACATAGGGCT pLX_317 95.7% 24.7% 25.6% V5 (many diffs) n/a
Download CSV