Transcript: Mouse XM_006521729.2

PREDICTED: Mus musculus calcium-sensing receptor (Casr), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Casr (12374)
Length:
7735
CDS:
614..3853

Additional Resources:

NCBI RefSeq record:
XM_006521729.2
NBCI Gene record:
Casr (12374)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521729.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027353 CCAACATGACTCTGGGATATA pLKO.1 879 CDS 100% 13.200 9.240 N Casr n/a
2 TRCN0000027328 CCAGAAGAGCAATGACACTTT pLKO.1 3616 CDS 100% 4.950 3.465 N Casr n/a
3 TRCN0000027324 GCACCTGAATTTCACCAACAA pLKO.1 2008 CDS 100% 4.950 3.465 N Casr n/a
4 TRCN0000027380 CGTCTTCATCAAGTTCCGAAA pLKO.1 2509 CDS 100% 4.050 2.835 N Casr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521729.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487915 TAAGTGGTTAGCTTAGGCCAATGG pLX_317 9.2% 87.5% 93.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV