Transcript: Mouse XM_006521780.2

PREDICTED: Mus musculus dishevelled segment polarity protein 3 (Dvl3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dvl3 (13544)
Length:
2639
CDS:
253..2406

Additional Resources:

NCBI RefSeq record:
XM_006521780.2
NBCI Gene record:
Dvl3 (13544)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296516 CAAGTCTATGGACGACGATTT pLKO_005 390 CDS 100% 10.800 8.640 N DVL3 n/a
2 TRCN0000097297 GCGGCTATGACAGTTCATCTA pLKO.1 761 CDS 100% 4.950 3.960 N Dvl3 n/a
3 TRCN0000097298 CTGGAGACTACCAGTTTCTTT pLKO.1 799 CDS 100% 5.625 3.938 N Dvl3 n/a
4 TRCN0000097294 GCTGGAGACTACCAGTTTCTT pLKO.1 798 CDS 100% 5.625 3.938 N Dvl3 n/a
5 TRCN0000097295 GCCCAGCTATAAGTTCTTCTT pLKO.1 369 CDS 100% 4.950 3.465 N Dvl3 n/a
6 TRCN0000097296 GCTCAAGATTACCATTCCCAA pLKO.1 1548 CDS 100% 2.640 1.848 N Dvl3 n/a
7 TRCN0000296465 CGTCACCTTGGCGGACTTTAA pLKO_005 333 CDS 100% 13.200 7.920 N DVL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06132 pDONR223 100% 89.4% 97.7% None (many diffs) n/a
2 ccsbBroad304_06132 pLX_304 26.3% 89.4% 97.7% V5 (many diffs) n/a
3 TRCN0000468071 AATAGTCATTGGCTTTGCTCCGAA pLX_317 14.8% 89.4% 97.7% V5 (many diffs) n/a
Download CSV