Transcript: Mouse XM_006521876.3

PREDICTED: Mus musculus beta galactoside alpha 2,6 sialyltransferase 1 (St6gal1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
St6gal1 (20440)
Length:
3955
CDS:
266..1477

Additional Resources:

NCBI RefSeq record:
XM_006521876.3
NBCI Gene record:
St6gal1 (20440)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018817 CCAAGTTGATATTTACGAGTT pLKO.1 1264 CDS 100% 4.050 5.670 N St6gal1 n/a
2 TRCN0000294588 CCAAGTTGATATTTACGAGTT pLKO_005 1264 CDS 100% 4.050 5.670 N St6gal1 n/a
3 TRCN0000018818 CGCTCCTCTTCGAGAAGAATA pLKO.1 1368 CDS 100% 13.200 9.240 N St6gal1 n/a
4 TRCN0000294589 CGCTCCTCTTCGAGAAGAATA pLKO_005 1368 CDS 100% 13.200 9.240 N St6gal1 n/a
5 TRCN0000018821 CCAGATCTGATTCAGCCGAAT pLKO.1 1193 CDS 100% 4.050 2.835 N St6gal1 n/a
6 TRCN0000294520 CCAGATCTGATTCAGCCGAAT pLKO_005 1193 CDS 100% 4.050 2.835 N St6gal1 n/a
7 TRCN0000018820 CCAGACTACAACTTCTTCGAA pLKO.1 1073 CDS 100% 3.000 2.100 N St6gal1 n/a
8 TRCN0000307367 CCAGACTACAACTTCTTCGAA pLKO_005 1073 CDS 100% 3.000 2.100 N St6gal1 n/a
9 TRCN0000018819 CGAGAGATTGATAATCATGAT pLKO.1 854 CDS 100% 4.950 2.970 N St6gal1 n/a
10 TRCN0000294521 CGAGAGATTGATAATCATGAT pLKO_005 854 CDS 100% 4.950 2.970 N St6gal1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.