Transcript: Mouse XM_006521947.1

PREDICTED: Mus musculus Casitas B-lineage lymphoma b (Cblb), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cblb (208650)
Length:
6774
CDS:
471..3419

Additional Resources:

NCBI RefSeq record:
XM_006521947.1
NBCI Gene record:
Cblb (208650)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521947.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244606 CCCTGATTTAACCGGATTATG pLKO_005 1484 CDS 100% 13.200 18.480 N Cblb n/a
2 TRCN0000244603 CTACACCTCACGATCATATAA pLKO_005 1510 CDS 100% 15.000 12.000 N Cblb n/a
3 TRCN0000244607 CTTGTACTCCAGTACCATAAT pLKO_005 4250 3UTR 100% 13.200 9.240 N Cblb n/a
4 TRCN0000244605 TGAGCGAGAATGAGTACTTTA pLKO_005 772 CDS 100% 13.200 9.240 N Cblb n/a
5 TRCN0000244604 CCAGATTTAGGCATCTATTTG pLKO_005 2742 CDS 100% 13.200 7.920 N Cblb n/a
6 TRCN0000039566 ATGCTATTCAGGATGCAGTT pLKO.1 550 CDS 100% 0.000 0.000 N CBLB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521947.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05939 pDONR223 100% 88% 95% None (many diffs) n/a
2 ccsbBroad304_05939 pLX_304 0% 88% 95% V5 (many diffs) n/a
3 TRCN0000465501 CTGAATGTTGTTTTAGAGTTACGA pLX_317 .6% 88% 95% V5 (many diffs) n/a
Download CSV