Transcript: Mouse XM_006522004.3

PREDICTED: Mus musculus ubiquitin-conjugating enzyme E2L 3 (Ube2l3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ube2l3 (22195)
Length:
2533
CDS:
52..420

Additional Resources:

NCBI RefSeq record:
XM_006522004.3
NBCI Gene record:
Ube2l3 (22195)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522004.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040827 CCACCCAAGATCACATTTAAA pLKO.1 148 CDS 100% 15.000 7.500 Y Ube2l3 n/a
2 TRCN0000317879 CCACCCAAGATCACATTTAAA pLKO_005 148 CDS 100% 15.000 7.500 Y Ube2l3 n/a
3 TRCN0000007212 GAATACTCTAAGGACCGTAAA pLKO.1 337 CDS 100% 10.800 5.400 Y UBE2L3 n/a
4 TRCN0000272913 GAATACTCTAAGGACCGTAAA pLKO_005 337 CDS 100% 10.800 5.400 Y UBE2L3 n/a
5 TRCN0000040826 CCACCAAGACTGACCAAGTAA pLKO.1 248 CDS 100% 5.625 2.813 Y Ube2l3 n/a
6 TRCN0000317880 CCACCAAGACTGACCAAGTAA pLKO_005 248 CDS 100% 5.625 2.813 Y Ube2l3 n/a
7 TRCN0000040824 CCAGCAGAGTATCCATTCAAA pLKO.1 127 CDS 100% 5.625 2.813 Y Ube2l3 n/a
8 TRCN0000317878 CCAGCAGAGTATCCATTCAAA pLKO_005 127 CDS 100% 5.625 2.813 Y Ube2l3 n/a
9 TRCN0000040825 GCTGAAGAGTTTACAAAGAAA pLKO.1 373 CDS 100% 5.625 2.813 Y Ube2l3 n/a
10 TRCN0000317881 GCTGAAGAGTTTACAAAGAAA pLKO_005 373 CDS 100% 5.625 2.813 Y Ube2l3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522004.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.