Transcript: Mouse XM_006522200.2

PREDICTED: Mus musculus xyloside xylosyltransferase 1 (Xxylt1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Xxylt1 (268880)
Length:
2826
CDS:
215..835

Additional Resources:

NCBI RefSeq record:
XM_006522200.2
NBCI Gene record:
Xxylt1 (268880)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158040 CCAGGACTTCTTCACCATGAT pLKO.1 643 CDS 100% 4.950 3.465 N XXYLT1 n/a
2 TRCN0000094001 CCTGAAGTATAAGACCAACAT pLKO.1 337 CDS 100% 4.950 3.465 N Xxylt1 n/a
3 TRCN0000093999 CCCTTGTAAAGAACTGGCTTT pLKO.1 1107 3UTR 100% 4.050 2.835 N Xxylt1 n/a
4 TRCN0000094000 GCTTGCTGACAAGTACCACTT pLKO.1 604 CDS 100% 4.050 2.835 N Xxylt1 n/a
5 TRCN0000094002 CGTCAAGATCTACCATGGGAA pLKO.1 787 CDS 100% 2.640 1.848 N Xxylt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13283 pDONR223 100% 48.2% 50.5% None (many diffs) n/a
2 ccsbBroad304_13283 pLX_304 0% 48.2% 50.5% V5 (many diffs) n/a
3 TRCN0000477318 CCGTACAGCATCACTATAATTTTG pLX_317 34.2% 48.2% 50.5% V5 (many diffs) n/a
Download CSV