Transcript: Mouse XM_006522272.2

PREDICTED: Mus musculus ABI gene family, member 3 (NESH) binding protein (Abi3bp), transcript variant X24, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abi3bp (320712)
Length:
5715
CDS:
112..4629

Additional Resources:

NCBI RefSeq record:
XM_006522272.2
NBCI Gene record:
Abi3bp (320712)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522272.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190845 GCGTCCAAATGCAAACGTAAA pLKO.1 255 CDS 100% 10.800 15.120 N Abi3bp n/a
2 TRCN0000430319 CATCTGATTATTCCGGGTCTT pLKO_005 928 CDS 100% 4.050 5.670 N Abi3bp n/a
3 TRCN0000420243 CCGAAGTATCTGATAGTCGTA pLKO_005 379 CDS 100% 2.640 3.696 N Abi3bp n/a
4 TRCN0000200577 CCCAACACAGTTTATGAATTT pLKO.1 667 CDS 100% 13.200 10.560 N Abi3bp n/a
5 TRCN0000416162 GCTTGAAAGTGCACATCAATA pLKO_005 203 CDS 100% 13.200 10.560 N Abi3bp n/a
6 TRCN0000202413 GCTCTGGGAAATGCACAGAAA pLKO.1 160 CDS 100% 4.950 3.465 N Abi3bp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522272.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07957 pDONR223 100% 60.5% 57.1% None (many diffs) n/a
2 ccsbBroad304_07957 pLX_304 0% 60.5% 57.1% V5 (many diffs) n/a
3 TRCN0000468708 CCGGTCCGCGTCGCACCTTAGAAA pLX_317 13.6% 60.5% 57.1% V5 (many diffs) n/a
Download CSV