Transcript: Mouse XM_006522635.3

PREDICTED: Mus musculus dynamin 1-like (Dnm1l), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dnm1l (74006)
Length:
4116
CDS:
180..2357

Additional Resources:

NCBI RefSeq record:
XM_006522635.3
NBCI Gene record:
Dnm1l (74006)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522635.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001099 CGAGATTGTGAGGTTATTGAA pLKO.1 2070 CDS 100% 5.625 7.875 N DNM1L n/a
2 TRCN0000318426 CGAGATTGTGAGGTTATTGAA pLKO_005 2070 CDS 100% 5.625 7.875 N DNM1L n/a
3 TRCN0000012606 CGGTGGTGCTAGGATTTGTTA pLKO.1 1262 CDS 100% 5.625 7.875 N Dnm1l n/a
4 TRCN0000321168 CGGTGGTGCTAGGATTTGTTA pLKO_005 1262 CDS 100% 5.625 7.875 N Dnm1l n/a
5 TRCN0000321169 GGCAATTGAGCTAGCGTATAT pLKO_005 1640 CDS 100% 13.200 10.560 N Dnm1l n/a
6 TRCN0000321170 CTATAATGCATGCACTATTTA pLKO_005 2704 3UTR 100% 15.000 10.500 N Dnm1l n/a
7 TRCN0000012604 GCCAACTGGATATTAACAATA pLKO.1 922 CDS 100% 13.200 9.240 N Dnm1l n/a
8 TRCN0000321167 GCCAACTGGATATTAACAATA pLKO_005 922 CDS 100% 13.200 9.240 N Dnm1l n/a
9 TRCN0000012605 GCTTCAGATCAGAGAACTTAT pLKO.1 668 CDS 100% 13.200 9.240 N Dnm1l n/a
10 TRCN0000321096 GCTTCAGATCAGAGAACTTAT pLKO_005 668 CDS 100% 13.200 9.240 N Dnm1l n/a
11 TRCN0000012607 CCTGCTTTATTTGTGCCTGAA pLKO.1 1389 CDS 100% 4.050 2.835 N Dnm1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522635.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02298 pDONR223 100% 89% 95.4% None (many diffs) n/a
2 ccsbBroad304_02298 pLX_304 0% 89% 95.4% V5 (many diffs) n/a
3 TRCN0000477846 GTGGCCGACCACGGGTCATCTCTT pLX_317 23% 89% 95.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV