Transcript: Mouse XM_006522705.3

PREDICTED: Mus musculus clusterin associated protein 1 (Cluap1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cluap1 (76779)
Length:
1854
CDS:
359..1624

Additional Resources:

NCBI RefSeq record:
XM_006522705.3
NBCI Gene record:
Cluap1 (76779)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250391 ATTTCCGCACACCCAACTTTG pLKO_005 402 CDS 100% 10.800 15.120 N Cluap1 n/a
2 TRCN0000250393 AGACTAAAGACCTGCTTAATA pLKO_005 918 CDS 100% 15.000 12.000 N Cluap1 n/a
3 TRCN0000250394 ATTAAGAGCCTCAGATGTATA pLKO_005 1647 3UTR 100% 13.200 9.240 N Cluap1 n/a
4 TRCN0000250392 CCGGCCTTTATGGATGAATAT pLKO_005 1040 CDS 100% 13.200 9.240 N Cluap1 n/a
5 TRCN0000258058 CCAGTCGAAGGATCCGTAAAC pLKO_005 1569 CDS 100% 10.800 7.560 N Cluap1 n/a
6 TRCN0000192698 GAAGACTAAAGACCTGCTTAA pLKO.1 916 CDS 100% 10.800 7.560 N Cluap1 n/a
7 TRCN0000201527 CCTTCTGACATTGAGACTGAA pLKO.1 482 CDS 100% 4.950 3.465 N Cluap1 n/a
8 TRCN0000216370 GATCACATCTGTTCTCTATAA pLKO.1 622 CDS 100% 13.200 7.920 N Cluap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11667 pDONR223 100% 82.4% 85% None (many diffs) n/a
2 ccsbBroad304_11667 pLX_304 0% 82.4% 85% V5 (many diffs) n/a
3 TRCN0000473920 AGAGAACGTGGGGCCACATATGAT pLX_317 30.4% 82.4% 85% V5 (many diffs) n/a
Download CSV