Transcript: Mouse XM_006522762.3

PREDICTED: Mus musculus transcription factor AP4 (Tfap4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tfap4 (83383)
Length:
2170
CDS:
442..1278

Additional Resources:

NCBI RefSeq record:
XM_006522762.3
NBCI Gene record:
Tfap4 (83383)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082125 CGAGCAGTTATCGTGAAGTCT pLKO.1 1141 CDS 100% 3.000 4.200 N Tfap4 n/a
2 TRCN0000244267 ACACAGCTCAAGCGCTTTATC pLKO_005 592 CDS 100% 13.200 9.240 N Tfap4 n/a
3 TRCN0000244373 CCTCCAGGGTTCCTGTTATTG pLKO_005 1899 3UTR 100% 13.200 9.240 N Tfap4 n/a
4 TRCN0000244266 GGAACAGAGGCGAGCAGTTAT pLKO_005 1131 CDS 100% 13.200 9.240 N Tfap4 n/a
5 TRCN0000244374 AGTCCCTCAAGACCCTCATTC pLKO_005 467 CDS 100% 10.800 7.560 N Tfap4 n/a
6 TRCN0000082124 CCAGCAGACAGCAGAATACAT pLKO.1 528 CDS 100% 5.625 3.938 N Tfap4 n/a
7 TRCN0000082127 CTGTCTCTACATCCCGGCAAA pLKO.1 1043 CDS 100% 4.050 2.835 N Tfap4 n/a
8 TRCN0000082126 AGATGGAGAGAAGCTCAGCAA pLKO.1 495 CDS 100% 2.640 1.584 N Tfap4 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 74 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01660 pDONR223 100% 74.4% 79.8% None (many diffs) n/a
2 ccsbBroad304_01660 pLX_304 0% 74.4% 79.8% V5 (many diffs) n/a
3 TRCN0000466681 CAAACCTTTCCCAAGCCTCCAATC pLX_317 33.6% 74.4% 79.8% V5 (many diffs) n/a
Download CSV