Transcript: Mouse XM_006522968.3

PREDICTED: Mus musculus single-minded homolog 2 (Drosophila) (Sim2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sim2 (20465)
Length:
2090
CDS:
275..1945

Additional Resources:

NCBI RefSeq record:
XM_006522968.3
NBCI Gene record:
Sim2 (20465)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522968.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095940 GCGAACTGTATATGCACGATA pLKO.1 2050 3UTR 100% 4.950 6.930 N Sim2 n/a
2 TRCN0000095941 GCGGTCTTTCTTTCTTCGAAT pLKO.1 442 CDS 100% 4.950 6.930 N Sim2 n/a
3 TRCN0000095942 CCTAAAGATCAGACAGTACAT pLKO.1 535 CDS 100% 4.950 3.465 N Sim2 n/a
4 TRCN0000095943 CCTTGACCTGAAGCTCATATT pLKO.1 682 CDS 100% 13.200 7.920 N Sim2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522968.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01536 pDONR223 100% 60.7% 59.8% None (many diffs) n/a
2 ccsbBroad304_01536 pLX_304 0% 60.7% 59.8% V5 (many diffs) n/a
3 TRCN0000472671 CTCCGTTCCATTCTTGTAGTAACT pLX_317 23.3% 60.7% 59.8% V5 (many diffs) n/a
Download CSV