Transcript: Mouse XM_006523057.1

PREDICTED: Mus musculus ubiquitin specific peptidase 25 (Usp25), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp25 (30940)
Length:
3768
CDS:
97..2547

Additional Resources:

NCBI RefSeq record:
XM_006523057.1
NBCI Gene record:
Usp25 (30940)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523057.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233430 GACGTGAACAATGGCTTAATT pLKO_005 2227 CDS 100% 15.000 21.000 N Usp25 n/a
2 TRCN0000233429 GGAGTGGCATGCAGATTATAA pLKO_005 1974 CDS 100% 15.000 21.000 N Usp25 n/a
3 TRCN0000233431 TAGTATAATGGAACCATATTG pLKO_005 3075 3UTR 100% 13.200 18.480 N Usp25 n/a
4 TRCN0000030824 CGGTGGATGAAGTATAATGAT pLKO.1 1000 CDS 100% 5.625 7.875 N Usp25 n/a
5 TRCN0000233428 CATCGCTGGAGGACGGAAATA pLKO_005 802 CDS 100% 13.200 9.240 N Usp25 n/a
6 TRCN0000233427 TTATATCTGGACAGGTATATG pLKO_005 337 CDS 100% 13.200 9.240 N Usp25 n/a
7 TRCN0000030827 CCCAACGATCACTGCAAGAAA pLKO.1 1268 CDS 100% 5.625 3.938 N Usp25 n/a
8 TRCN0000030826 GCTTGATTGTTCTACAGAGAT pLKO.1 2415 CDS 100% 4.950 3.465 N Usp25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523057.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03088 pDONR223 100% 56.2% 59.9% None (many diffs) n/a
2 ccsbBroad304_03088 pLX_304 0% 56.2% 59.9% V5 (many diffs) n/a
3 TRCN0000467162 GTTAGACCGGTCGCTGGTCCGGGT pLX_317 14.4% 56.2% 59.9% V5 (many diffs) n/a
Download CSV