Construct: ORF TRCN0000467162
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017710.1_s317c1
- Derived from:
- ccsbBroadEn_03088
- DNA Barcode:
- GTTAGACCGGTCGCTGGTCCGGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USP25 (29761)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467162
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 29761 | USP25 | ubiquitin specific peptidas... | NM_013396.6 | 100% | 100% | |
| 2 | human | 29761 | USP25 | ubiquitin specific peptidas... | NM_001283042.3 | 97% | 97% | 2337_2432del |
| 3 | human | 29761 | USP25 | ubiquitin specific peptidas... | NM_001283041.2 | 93.7% | 93.7% | 2337_2546del |
| 4 | human | 29761 | USP25 | ubiquitin specific peptidas... | NM_001352560.2 | 79% | 79% | 0_1ins663 |
| 5 | human | 29761 | USP25 | ubiquitin specific peptidas... | XM_011529529.1 | 77.8% | 77% | (many diffs) |
| 6 | human | 29761 | USP25 | ubiquitin specific peptidas... | XM_017028325.1 | 74.5% | 73.5% | (many diffs) |
| 7 | human | 29761 | USP25 | ubiquitin specific peptidas... | XM_017028322.1 | 74.1% | 74.1% | 0_1ins663;1674_1883del |
| 8 | human | 29761 | USP25 | ubiquitin specific peptidas... | XM_017028323.2 | 74.1% | 74.1% | 0_1ins663;1674_1883del |
| 9 | human | 29761 | USP25 | ubiquitin specific peptidas... | XM_024452063.1 | 74.1% | 74.1% | 0_1ins663;1674_1883del |
| 10 | human | 29761 | USP25 | ubiquitin specific peptidas... | XM_024452064.1 | 70.3% | 68.6% | 0_1ins715;65_66ins77;1545_1754del |
| 11 | human | 29761 | USP25 | ubiquitin specific peptidas... | NM_001352561.2 | 61.7% | 61.7% | 0_1ins1212 |
| 12 | human | 29761 | USP25 | ubiquitin specific peptidas... | XR_002958593.1 | 60.6% | 1_447del;2439_2459del;3634_5220del | |
| 13 | human | 29761 | USP25 | ubiquitin specific peptidas... | XR_002958592.1 | 59.5% | 1_447del;3043_3153del;3724_5313del | |
| 14 | human | 29761 | USP25 | ubiquitin specific peptidas... | XR_001754834.1 | 58% | 1_447del;2640_2641ins143;3470_5059del | |
| 15 | human | 29761 | USP25 | ubiquitin specific peptidas... | XM_005260949.4 | 57.8% | 57.8% | 0_1ins1212;1125_1334del |
| 16 | human | 29761 | USP25 | ubiquitin specific peptidas... | XM_017028327.1 | 57.8% | 57.8% | 0_1ins1212;1125_1334del |
| 17 | human | 29761 | USP25 | ubiquitin specific peptidas... | XM_011529535.2 | 53.5% | 53.4% | 1693_1696delGGTT;1698T>A;1701_1702ins1468 |
| 18 | mouse | 30940 | Usp25 | ubiquitin specific peptidas... | NM_013918.2 | 87.8% | 93.8% | (many diffs) |
| 19 | mouse | 30940 | Usp25 | ubiquitin specific peptidas... | XM_006523056.2 | 82.3% | 88% | (many diffs) |
| 20 | mouse | 30940 | Usp25 | ubiquitin specific peptidas... | XM_006523055.2 | 81.7% | 87.3% | (many diffs) |
| 21 | mouse | 30940 | Usp25 | ubiquitin specific peptidas... | XM_006523057.1 | 56.2% | 59.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 3231
- ORF length:
- 3165
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac cgtggagcag aacgtgctgc agcagagcgc ggcgcagaag caccagcaga 121 cgtttttgaa tcaactgaga gaaattacgg ggattaatga cacccagata ctacagcaag 181 ccttgaagga tagtaatgga aacttggaat tagcagtggc tttccttact gcgaagaatg 241 ctaagacccc tcagcaggag gagacaactt actaccaaac agcacttcct ggcaatgata 301 gatacatcag tgtgggaagc caagcagata caaatgtgat tgatctcact ggagatgata 361 aagatgatct tcagagagca attgccttga gtttggccga atcaaacagg gcattcaggg 421 agactggaat aactgatgag gaacaagcca ttagcagagt tcttgaagcc agcatagcag 481 agaataaagc atgtttgaag aggacaccta cagaagtttg gagggattct cgaaaccctt 541 atgatagaaa aagacaggac aaagctcccg ttgggctaaa gaatgttggc aatacttgtt 601 ggtttagtgc tgttattcag tcattattta atcttttgga atttagaaga ttagttctga 661 attacaagcc tccatcaaat gctcaagatt taccccgaaa ccaaaaggaa catcggaatt 721 tgccttttat gcgtgagctg aggtatctat ttgcacttct tgttggtacc aaaaggaagt 781 atgttgatcc atcaagagca gttgaaattc ttaaggatgc tttcaaatca aatgactcac 841 agcagcaaga tgtgagtgag tttacacaca aattattaga ttggttagaa gatgccttcc 901 aaatgaaagc tgaagaggag acggatgaag agaagccaaa gaaccccatg gtagagttgt 961 tctatggcag attcctggct gtgggagtac ttgaaggtaa aaaatttgaa aacactgaaa 1021 tgtttggtca gtacccactt caggtcaatg ggttcaaaga tctgcatgag tgcctagaag 1081 ctgcaatgat tgaaggagaa attgagtctt tacattcaga gaattcagga aaatcaggcc 1141 aagagcattg gtttactgaa ttaccacctg tgttaacatt tgaattgtca agatttgaat 1201 ttaatcaggc attgggaaga ccagaaaaaa ttcacaacaa attagaattt ccccaagttt 1261 tatatttgga cagatacatg cacagaaaca gagaaataac aagaattaag agggaagaga 1321 tcaagagact gaaagattac ctcacggtat tacaacaaag gctagaaaga tatttaagct 1381 atggttccgg tcccaaacga ttccccttgg tagatgttct tcagtatgca ttggaatttg 1441 cctcaagtaa acctgtttgc acttctcctg ttgacgatat tgacgctagt tccccaccta 1501 gtggttccat accatcacag acattaccaa gcacaacaga acaacaggga gccctatctt 1561 cagaactgcc aagcacatca ccttcatcag ttgctgccat ttcatcgaga tcagtaatac 1621 acaaaccatt tactcagtcc cggatacctc cagatttgcc catgcatccg gcaccaaggc 1681 acataacgga ggaagaactt tctgtgctgg aaagttgttt acatcgctgg aggacagaaa 1741 tagaaaatga caccagagat ttgcaggaaa gcatatccag aatccatcga acaattgaat 1801 taatgtactc tgacaaatct atgatacaag ttccttatcg attacatgcc gttttagttc 1861 acgaaggcca agctaatgct gggcactact gggcatatat ttttgatcat cgtgaaagca 1921 gatggatgaa gtacaatgat attgctgtga caaaatcatc atgggaagag ctagtgaggg 1981 actcttttgg tggttataga aatgccagtg catactgttt aatgtacata aatgataagg 2041 cacagttcct aatacaagag gagtttaata aagaaactgg gcagcccctt gttggtatag 2101 aaacattacc accggatttg agagattttg ttgaggaaga caaccaacga tttgaaaaag 2161 aactagaaga atgggatgca caacttgccc agaaagcttt gcaggaaaag cttttagcgt 2221 ctcagaaatt gagagagtca gagacttctg tgacaacagc acaagcagca ggagacccag 2281 aatatctaga gcagccatca agaagtgatt tctcaaagca cttgaaagaa gaaactattc 2341 aaataattac caaggcatca catgagcatg aagataaaag tcctgaaaca gttttgcagt 2401 cggcaattaa gttggaatat gcaaggttgg ttaagttggc ccaagaagac accccaccag 2461 aaaccgatta tcgtttacat catgtagtgg tctactttat ccagaaccag gcaccaaaga 2521 aaattattga gaaaacatta ctagaacaat ttggagatag aaatttgagt tttgatgaaa 2581 ggtgtcacaa cataatgaaa gttgctcaag ccaaactgga aatgataaaa cctgaagaag 2641 taaacttgga ggaatatgag gagtggcatc aggattatag gaaattcagg gaaacaacta 2701 tgtatctcat aattgggcta gaaaattttc aaagagaaag ttatatagat tccttgctgt 2761 tcctcatctg tgcttatcag aaTAACAAAG AACTCTTGTC TAAAGGCTTA TACAGAGGAC 2821 ATGATGAAGA ATTGATATCA CATTATAGAA GAGAATGTTT GCTAAAATTA AATGAGCAAG 2881 CCGCAGAACT CTTCGAATCT GGAGAGGATC GAGAAGTAAA CAATGGTTTG ATTATCATGA 2941 ATGAGTTTAT TGTCCCATTT TTGCCATTAT TACTGGTGGA TGAAATGGAA GAAAAGGATA 3001 TACTAGCTGT AGAAGATATG AGAAATCGAT GGTGTTCCTA CCTTGGTCAA GAAATGGAAC 3061 CACACCTCCA AGAAAAGCTG ACAGATTTTT TGCCAAAACT GCTTGATTGT TCTATGGAGA 3121 TTAAAAGTTT CCATGAGCCA CCGAAGTTAC CTTCATATTC CACGCATGAA CTCTGTGAGC 3181 GATTTGCCCG AATCATGTTG TCCCTCAGTC GAACTCCTGC TGATGGAAGA TACCCAACTT 3241 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 3301 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 3361 CTTGTGGAAA GGACGAGTTA GACCGGTCGC TGGTCCGGGT ACGCGTTAAG TCgacaatca 3421 acctctggat tacaaaattt gtgaaagatt