Transcript: Mouse XM_006523220.3

PREDICTED: Mus musculus transcription factor B1, mitochondrial (Tfb1m), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tfb1m (224481)
Length:
961
CDS:
65..733

Additional Resources:

NCBI RefSeq record:
XM_006523220.3
NBCI Gene record:
Tfb1m (224481)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523220.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081981 CTGGCAGTCTAGCAGATGTTT pLKO.1 216 CDS 100% 5.625 3.938 N Tfb1m n/a
2 TRCN0000302015 CTGGCAGTCTAGCAGATGTTT pLKO_005 216 CDS 100% 5.625 3.938 N Tfb1m n/a
3 TRCN0000081979 CCTCTTTACAATCCCAGGAAA pLKO.1 688 CDS 100% 4.950 3.465 N Tfb1m n/a
4 TRCN0000302020 CCTCTTTACAATCCCAGGAAA pLKO_005 688 CDS 100% 4.950 3.465 N Tfb1m n/a
5 TRCN0000081982 ACTCGCTTTATCCCAGGGTTA pLKO.1 326 CDS 100% 4.050 2.835 N Tfb1m n/a
6 TRCN0000081980 GCCCTTTCGTTTATGGCAGAA pLKO.1 552 CDS 100% 4.050 2.835 N Tfb1m n/a
7 TRCN0000302078 GCCCTTTCGTTTATGGCAGAA pLKO_005 552 CDS 100% 4.050 2.835 N Tfb1m n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523220.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03207 pDONR223 100% 56% 55.4% None (many diffs) n/a
2 ccsbBroad304_03207 pLX_304 0% 56% 55.4% V5 (many diffs) n/a
3 TRCN0000473484 ACTGCATTCTTTTGTGGAGTTTCA pLX_317 36% 56% 55.4% V5 (many diffs) n/a
Download CSV