Construct: ORF TRCN0000473484
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004071.1_s317c1
- Derived from:
- ccsbBroadEn_03207
- DNA Barcode:
- ACTGCATTCTTTTGTGGAGTTTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TFB1M (51106)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473484
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51106 | TFB1M | transcription factor B1, mi... | NM_016020.4 | 100% | 100% | |
| 2 | human | 51106 | TFB1M | transcription factor B1, mi... | NM_001350501.2 | 83.2% | 83.2% | 790_791ins174 |
| 3 | human | 51106 | TFB1M | transcription factor B1, mi... | XR_942460.2 | 77.8% | 1_69del;734_901del;1230_1231ins45 | |
| 4 | human | 51106 | TFB1M | transcription factor B1, mi... | NM_001350502.2 | 72.5% | 72.5% | 0_1ins285 |
| 5 | human | 51106 | TFB1M | transcription factor B1, mi... | XM_011535873.2 | 72.5% | 72.5% | 0_1ins285 |
| 6 | human | 51106 | TFB1M | transcription factor B1, mi... | XM_017010917.1 | 72.5% | 72.5% | 0_1ins285 |
| 7 | human | 51106 | TFB1M | transcription factor B1, mi... | XM_011535870.1 | 70.7% | 67.3% | (many diffs) |
| 8 | human | 51106 | TFB1M | transcription factor B1, mi... | XM_011535871.2 | 70.7% | 67.3% | (many diffs) |
| 9 | human | 51106 | TFB1M | transcription factor B1, mi... | XM_011535872.2 | 70.7% | 67.3% | (many diffs) |
| 10 | human | 51106 | TFB1M | transcription factor B1, mi... | NR_146725.2 | 47.4% | (many diffs) | |
| 11 | human | 51106 | TFB1M | transcription factor B1, mi... | XR_001743453.1 | 16.9% | 1_69del;859_860ins174;934_4913del | |
| 12 | mouse | 224481 | Tfb1m | transcription factor B1, mi... | NM_146074.1 | 85.2% | 84.6% | (many diffs) |
| 13 | mouse | 224481 | Tfb1m | transcription factor B1, mi... | XM_006523220.3 | 56% | 55.4% | (many diffs) |
| 14 | mouse | 224481 | Tfb1m | transcription factor B1, mi... | XR_385130.2 | 52.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1104
- ORF length:
- 1038
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tgcctccgga aaactcagca cttgccgtct ccctccgttg cccacgattc 121 gagaaatcat taagttgtta agactgcaag cagcgaagca gctatcacag aatttcctcc 181 tggacttgag gctgacagat aagattgtaa ggaaagctgg caatctgaca aatgcttatg 241 tttacgaagt gggccctggg ccagggggaa tcacaagatc tattcttaat gccgacgtcg 301 ctgaacttct ggtggttgaa aaggacactc gatttattcc tggattacag atgctttctg 361 atgcagcacc tgggaaactg agaattgttc atggagatgt cttgacattt aaggtagaaa 421 aggctttttc agaaagtctt aaaagaccct gggaagatga tcctccaaat gtacatatta 481 ttggaaatct gccttttagt gtttcaactc cactgattat caagtggctt gaaaatattt 541 cctgtagaga tggacctttt gtttatggca gaactcagat gactttgact tttcaaaagg 601 aagtggcaga gagacttgca gccaatacag gaagcaaaca gcgtagtcgc ctctctgtta 661 tggctcagta cctctgcaat gttcgacaca tctttacgat tccaggacaa gcttttgtcc 721 ccaaaccaga ggtGGACGTG GGCGTGGTGC ACTTCACTCC CTTGATACAG CCCAAGATAG 781 AGCAGCCATT CAAGCTGGTG GAAAAAGTGG TTCAGAATGT ATTTCAGTTC CGAAGGAAAT 841 ACTGCCATCG AGGGCTCAGA ATGTTATTCC CTGAAGCGCA GCGCTTGGAA AGCACGGGCA 901 GGCTGTTAGA GTTGGCAGAC ATAGACCCTA CTCTTCGGCC CCGCCAGCTC TCCATCTCAC 961 ACTTTAAGAG CCTCTGTGAT GTATACAGAA AAATGTGTGA TGAAGACCCA CAACTCTTTG 1021 CATATAATTT CAGAGAAGAA CTCAAGCGAA GAAAAAGCAA AAATGAAGAA AAAGAAGAGG 1081 ATGACGCAGA GAATTACAGA CTCTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1141 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1201 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA CTGCATTCTT 1261 TTGTGGAGTT TCAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1321 att