Transcript: Mouse XM_006523319.3

PREDICTED: Mus musculus phosphodiesterase 10A (Pde10a), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pde10a (23984)
Length:
8253
CDS:
868..3261

Additional Resources:

NCBI RefSeq record:
XM_006523319.3
NBCI Gene record:
Pde10a (23984)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523319.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321306 TTCCTACTCGACGTATCAAAG pLKO_005 1654 CDS 100% 10.800 15.120 N Pde10a n/a
2 TRCN0000077318 CCCTTGTTGTGAAGTTTACAT pLKO.1 3641 3UTR 100% 5.625 7.875 N Pde10a n/a
3 TRCN0000321240 GCTTGGGCTTCCGTAGCAATA pLKO_005 1582 CDS 100% 10.800 8.640 N Pde10a n/a
4 TRCN0000005479 CCACTTTGACATTGGTCCTTT pLKO.1 2295 CDS 100% 4.950 3.960 N PDE10A n/a
5 TRCN0000321307 CTTGAACACATCATGATATAT pLKO_005 1711 CDS 100% 15.000 10.500 N Pde10a n/a
6 TRCN0000321308 GAGCGCAAAGGCCTGCTAATT pLKO_005 2524 CDS 100% 13.200 9.240 N Pde10a n/a
7 TRCN0000321305 TGTGACCTTCTTATAGGTTAA pLKO_005 3661 3UTR 100% 10.800 7.560 N Pde10a n/a
8 TRCN0000077320 CGACGGATTTGCACTGTACTT pLKO.1 1227 CDS 100% 4.950 3.465 N Pde10a n/a
9 TRCN0000077321 GCGAATGATATATATGCAGAA pLKO.1 2935 CDS 100% 4.050 2.835 N Pde10a n/a
10 TRCN0000077322 CCTTACCACAACTGGAAGCAT pLKO.1 2437 CDS 100% 3.000 2.100 N Pde10a n/a
11 TRCN0000077319 CGACGTATCAAAGACATACTT pLKO.1 1662 CDS 100% 5.625 3.375 N Pde10a n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4827 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523319.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07690 pDONR223 100% 84.5% 91.1% None (many diffs) n/a
2 ccsbBroad304_07690 pLX_304 0% 84.5% 91.1% V5 (many diffs) n/a
3 TRCN0000477378 CGTGACATACTACGCATGCAACGC pLX_317 17.5% 84.5% 91.1% V5 (many diffs) n/a
4 TRCN0000487706 TACCGCGTATTGAGCTCGGTTCTG pLX_317 10.1% 84.5% 91.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV