Transcript: Mouse XM_006523369.1

PREDICTED: Mus musculus predicted gene 3417 (Gm3417), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm3417 (100041586)
Length:
561
CDS:
87..506

Additional Resources:

NCBI RefSeq record:
XM_006523369.1
NBCI Gene record:
Gm3417 (100041586)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523369.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282073 ATGTTCGAGAAGGAGTCATAT pLKO_005 171 CDS 100% 13.200 6.600 Y Gm3417 n/a
2 TRCN0000126543 CCTCCGTTTGATGACTCAATT pLKO.1 249 CDS 100% 13.200 6.600 Y Tcte3 n/a
3 TRCN0000126540 GCACATTTGGTAGAAACTAAA pLKO.1 357 CDS 100% 13.200 6.600 Y Tcte3 n/a
4 TRCN0000262071 CTCCGTTTGATGACTCAATTG pLKO_005 250 CDS 100% 10.800 5.400 Y Gm3417 n/a
5 TRCN0000262751 TCAAGCACATTTGGTAGAAAC pLKO_005 353 CDS 100% 10.800 5.400 Y Gm3448 n/a
6 TRCN0000262753 AGTACGTGGAACCTCCGTTTG pLKO_005 238 CDS 100% 6.000 3.000 Y Gm3448 n/a
7 TRCN0000126541 GAGAGAAAGGAAGCCTAGCAT pLKO.1 152 CDS 100% 3.000 1.500 Y Tcte3 n/a
8 TRCN0000143395 GAGAAAGACTGAGAGAGTCAA pLKO.1 205 CDS 100% 4.950 2.475 Y TCTE3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523369.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01656 pDONR223 100% 61.2% 56% None (many diffs) n/a
2 ccsbBroad304_01656 pLX_304 0% 61.2% 56% V5 (many diffs) n/a
3 TRCN0000478934 ACCACCTGGCATTACCAGCTGAAT pLX_317 82.4% 61.2% 56% V5 (many diffs) n/a
Download CSV