Transcript: Mouse XM_006523445.2

PREDICTED: Mus musculus tau tubulin kinase 1 (Ttbk1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttbk1 (106763)
Length:
5908
CDS:
300..2597

Additional Resources:

NCBI RefSeq record:
XM_006523445.2
NBCI Gene record:
Ttbk1 (106763)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339259 CTACTTCACCAAGCCCGATTA pLKO_005 1136 CDS 100% 10.800 15.120 N Ttbk1 n/a
2 TRCN0000023809 CGTAACGAGAAGTTTAACTAT pLKO.1 591 CDS 100% 5.625 7.875 N LOC210619 n/a
3 TRCN0000079151 CGGCAGCTCTTAAGGACGAAA pLKO.1 313 CDS 100% 4.950 6.930 N LOC433112 n/a
4 TRCN0000023811 GCCCGATTACCAGTTGATCAT pLKO.1 1148 CDS 100% 4.950 6.930 N LOC210619 n/a
5 TRCN0000339258 CTAGCCAGGCAGTACACTAAC pLKO_005 834 CDS 100% 10.800 8.640 N Ttbk1 n/a
6 TRCN0000079149 GCCAACTACGTGGTCAAAGAT pLKO.1 375 CDS 100% 5.625 4.500 N LOC433112 n/a
7 TRCN0000023812 CAGCAAGGAGTGGGTCATTAT pLKO.1 1919 CDS 100% 13.200 9.240 N LOC210619 n/a
8 TRCN0000339191 ACATCAAGCCGTCCAACTTTG pLKO_005 760 CDS 100% 10.800 7.560 N Ttbk1 n/a
9 TRCN0000037534 CCAGTTGATCATGTCAGTGTT pLKO.1 1157 CDS 100% 4.950 3.465 N TTBK1 n/a
10 TRCN0000023813 CTGGAGGAAGATCAAAGACAA pLKO.1 1013 CDS 100% 4.950 3.465 N LOC210619 n/a
11 TRCN0000023810 GCCATGTTTGGAGTGGTCAAT pLKO.1 1305 CDS 100% 4.950 3.465 N LOC210619 n/a
12 TRCN0000339261 ACAGCAAGGAGTGGGTCATTA pLKO_005 1918 CDS 100% 13.200 7.920 N Ttbk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.