Transcript: Mouse XM_006523468.1

PREDICTED: Mus musculus fibroblast growth factor receptor substrate 3 (Frs3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Frs3 (107971)
Length:
2152
CDS:
251..1729

Additional Resources:

NCBI RefSeq record:
XM_006523468.1
NBCI Gene record:
Frs3 (107971)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426413 AGGGTTCTCAAGGTTGCATTT pLKO_005 1929 3UTR 100% 10.800 15.120 N Frs3 n/a
2 TRCN0000097331 CGCGGGTCTTCAACTTTGATT pLKO.1 1440 CDS 100% 5.625 7.875 N Frs3 n/a
3 TRCN0000433309 AGTCTACCCACACCCTCATTG pLKO_005 786 CDS 100% 10.800 7.560 N Frs3 n/a
4 TRCN0000097330 GCCGTGATTGACCTCAAGAAA pLKO.1 1616 CDS 100% 5.625 3.938 N Frs3 n/a
5 TRCN0000097333 CAACCACCCTACCAAGTTCAA pLKO.1 295 CDS 100% 4.950 3.465 N Frs3 n/a
6 TRCN0000097332 GCAGTCTCACACCTATGTCAA pLKO.1 817 CDS 100% 4.950 3.465 N Frs3 n/a
7 TRCN0000097329 GCTGTCCATGTGTTTGTGCTT pLKO.1 1986 3UTR 100% 2.640 1.848 N Frs3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07686 pDONR223 100% 83% 84.8% None (many diffs) n/a
2 ccsbBroad304_07686 pLX_304 0% 83% 84.8% V5 (many diffs) n/a
3 TRCN0000467161 CTCAACGGAAAATATCTGAGTTTC pLX_317 29.2% 83% 84.8% V5 (many diffs) n/a
Download CSV