Transcript: Mouse XM_006523650.4

PREDICTED: Mus musculus fer (fms/fps related) protein kinase (Fer), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Fer (14158)
Length:
1710
CDS:
299..1567

Additional Resources:

NCBI RefSeq record:
XM_006523650.4
NBCI Gene record:
Fer (14158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523650.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523650.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14636 pDONR223 0% 45.9% 47.9% None (many diffs) n/a
2 ccsbBroad304_14636 pLX_304 0% 45.9% 47.9% V5 (many diffs) n/a
3 TRCN0000481126 AGGCTGTACATTGACAACTCCGAA pLX_317 17% 45.9% 47.9% V5 (many diffs) n/a
4 TRCN0000489132 AGAAAATTTGATATAATTGCCAAT pLX_317 13.3% 45.8% 47.8% V5 (many diffs) n/a
Download CSV