Transcript: Mouse XM_006523673.3

PREDICTED: Mus musculus histocompatibility 2, K1, K region (H2-K1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
H2-K1 (14972)
Length:
2133
CDS:
42..1418

Additional Resources:

NCBI RefSeq record:
XM_006523673.3
NBCI Gene record:
H2-K1 (14972)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523673.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314205 ACAGCAGACCTGAAGATAAAG pLKO_005 739 CDS 100% 13.200 9.240 N H2-K1 n/a
2 TRCN0000314203 GAATGTAACCTTGATTGTTAT pLKO_005 1977 3UTR 100% 13.200 9.240 N H2-K1 n/a
3 TRCN0000314149 GATGGTTCATGACCCTCATTC pLKO_005 1643 3UTR 100% 10.800 7.560 N H2-K1 n/a
4 TRCN0000314144 CCTTGGAGCTGCAATAGTCAC pLKO_005 1040 CDS 100% 4.050 2.835 N H2-K1 n/a
5 TRCN0000066806 GCAGACCTGAAGATAAAGTCA pLKO.1 742 CDS 100% 3.000 2.100 N H2-K1 n/a
6 TRCN0000113991 CCCTCAGTTCTCTTTAGTCAA pLKO.1 1740 3UTR 100% 4.950 2.970 N H2-D1 n/a
7 TRCN0000066807 AGCAGAGAGACTCAGGGCCTA pLKO.1 620 CDS 100% 0.720 0.432 N H2-K1 n/a
8 TRCN0000066948 CAGAGCCCTCAGTTCTCTTTA pLKO.1 1735 3UTR 100% 13.200 6.600 Y H2-Q7 n/a
9 TRCN0000374453 GACGCGGAGAATCCGAGATAT pLKO_005 279 CDS 100% 13.200 6.600 Y H2-D1 n/a
10 TRCN0000066566 GCCCTGAACGAAGACCTGAAA pLKO.1 537 CDS 100% 4.950 2.475 Y H2-Q8 n/a
11 TRCN0000066805 CAGATACCTGAAGAACGGGAA pLKO.1 671 CDS 100% 2.160 1.080 Y H2-K1 n/a
12 TRCN0000318013 CAGATACCTGAAGAACGGGAA pLKO_005 671 CDS 100% 2.160 1.080 Y H2-K1 n/a
13 TRCN0000066803 GTATTACACATGCCATGTGTA pLKO.1 929 CDS 100% 0.495 0.248 Y H2-K1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523673.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.