Transcript: Mouse XM_006524118.3

PREDICTED: Mus musculus BCL2-associated athanogene 6 (Bag6), transcript variant X16, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bag6 (224727)
Length:
3937
CDS:
157..3852

Additional Resources:

NCBI RefSeq record:
XM_006524118.3
NBCI Gene record:
Bag6 (224727)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524118.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249136 CCCTGAATGGGTCCCTATTAT pLKO_005 3498 CDS 100% 15.000 21.000 N Bag6 n/a
2 TRCN0000174045 CTTCAGCTAGTGCTGGTACTA pLKO.1 2168 CDS 100% 4.950 6.930 N Bag6 n/a
3 TRCN0000193810 CTTCCACCACTGTTGATTCAT pLKO.1 1529 CDS 100% 5.625 4.500 N Bag6 n/a
4 TRCN0000249137 AGCACATGATTAGGGATATAC pLKO_005 788 CDS 100% 13.200 9.240 N Bag6 n/a
5 TRCN0000249134 GATGAATGTAAAGGAGTTTAA pLKO_005 387 CDS 100% 13.200 9.240 N Bag6 n/a
6 TRCN0000249135 GTGGATATCATCCGGACAAAT pLKO_005 2947 CDS 100% 13.200 9.240 N Bag6 n/a
7 TRCN0000249133 TCAGCATCCCTTCCGAGAAAC pLKO_005 428 CDS 100% 10.800 7.560 N Bag6 n/a
8 TRCN0000007357 CCTATTATCCAGCAGGACATT pLKO.1 3511 CDS 100% 4.950 3.465 N BAG6 n/a
9 TRCN0000279904 CCTATTATCCAGCAGGACATT pLKO_005 3511 CDS 100% 4.950 3.465 N BAG6 n/a
10 TRCN0000173784 CTGCCAAGAGACGAAAGACAA pLKO.1 3593 CDS 100% 4.950 3.465 N Bag6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524118.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01841 pDONR223 100% 81.5% 86.3% None (many diffs) n/a
2 ccsbBroad304_01841 pLX_304 0% 81.5% 86.3% V5 (many diffs) n/a
3 TRCN0000479428 CAAACTTTCCGCGCCATGCGTCGA pLX_317 .6% 81.5% 86.3% V5 (many diffs) n/a
Download CSV