Transcript: Mouse XM_006524251.1

PREDICTED: Mus musculus copine V (Cpne5), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cpne5 (240058)
Length:
2676
CDS:
174..1562

Additional Resources:

NCBI RefSeq record:
XM_006524251.1
NBCI Gene record:
Cpne5 (240058)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111708 GCCTCTCACGATAGGAACATT pLKO.1 125 5UTR 100% 5.625 7.875 N Cpne5 n/a
2 TRCN0000111705 CGCATGGTGATAGTGATGTTT pLKO.1 2571 3UTR 100% 5.625 4.500 N Cpne5 n/a
3 TRCN0000111709 CCTATGTCGATCATCATTGTT pLKO.1 1224 CDS 100% 5.625 3.938 N Cpne5 n/a
4 TRCN0000111706 GCCAACAAGCTGGATAAGAAA pLKO.1 333 CDS 100% 5.625 3.938 N Cpne5 n/a
5 TRCN0000111707 CCCACTAACTTTGCTCCTGTT pLKO.1 1071 CDS 100% 4.050 2.835 N Cpne5 n/a
6 TRCN0000418238 CATTCAGCATTATGACAGTGA pLKO_005 887 CDS 100% 2.640 1.848 N Cpne5 n/a
7 TRCN0000141026 CAGGGAAGAAATGTGGTACAA pLKO.1 253 CDS 100% 4.950 3.465 N CPNE8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12396 pDONR223 100% 58.2% 63.2% None (many diffs) n/a
2 ccsbBroad304_12396 pLX_304 0% 58.2% 63.2% V5 (many diffs) n/a
3 TRCN0000470806 GGGTAGCATGCGGCTCGGCCTCGC pLX_317 51.7% 58.2% 63.2% V5 (many diffs) n/a
Download CSV