Transcript: Mouse XM_006524348.3

PREDICTED: Mus musculus latent transforming growth factor beta binding protein 1 (Ltbp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ltbp1 (268977)
Length:
6420
CDS:
63..5198

Additional Resources:

NCBI RefSeq record:
XM_006524348.3
NBCI Gene record:
Ltbp1 (268977)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524348.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310764 GATGACCTGTGTCGATGTAAA pLKO_005 5003 CDS 100% 13.200 18.480 N LTBP1 n/a
2 TRCN0000065586 CCATAGACACTGTCAAGATAT pLKO.1 3254 CDS 100% 13.200 9.240 N Ltbp1 n/a
3 TRCN0000065583 CCCAAGAAACAATCCTATCAT pLKO.1 1830 CDS 100% 5.625 3.938 N Ltbp1 n/a
4 TRCN0000065584 CCCTCCAAATTTCACAGGAAA pLKO.1 1301 CDS 100% 4.950 3.465 N Ltbp1 n/a
5 TRCN0000065585 CCTGTCAAATTACAGTGCTTT pLKO.1 4410 CDS 100% 4.950 3.465 N Ltbp1 n/a
6 TRCN0000065587 CCCAACATAGTCAATATCCAT pLKO.1 1476 CDS 100% 3.000 2.100 N Ltbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524348.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13894 pDONR223 100% 70.9% 34.5% None (many diffs) n/a
2 ccsbBroad304_13894 pLX_304 0% 70.9% 34.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV