Transcript: Mouse XM_006524370.2

PREDICTED: Mus musculus ATP-binding cassette, sub-family A (ABC1), member 3 (Abca3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abca3 (27410)
Length:
6573
CDS:
658..5772

Additional Resources:

NCBI RefSeq record:
XM_006524370.2
NBCI Gene record:
Abca3 (27410)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524370.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113388 GCTTATATTCATGGGTACGAA pLKO.1 2425 CDS 100% 3.000 4.200 N Abca3 n/a
2 TRCN0000316149 GCTTATATTCATGGGTACGAA pLKO_005 2425 CDS 100% 3.000 4.200 N Abca3 n/a
3 TRCN0000113386 GCCGAACATCTTTACTTCTAT pLKO.1 2527 CDS 100% 5.625 4.500 N Abca3 n/a
4 TRCN0000316077 GCCGAACATCTTTACTTCTAT pLKO_005 2527 CDS 100% 5.625 4.500 N Abca3 n/a
5 TRCN0000113387 GCACCAAGACATGGTCCATTA pLKO.1 5586 CDS 100% 10.800 7.560 N Abca3 n/a
6 TRCN0000316151 GCACCAAGACATGGTCCATTA pLKO_005 5586 CDS 100% 10.800 7.560 N Abca3 n/a
7 TRCN0000113389 CTTCAGTTACACACGAAGAAA pLKO.1 1122 CDS 100% 5.625 3.938 N Abca3 n/a
8 TRCN0000349148 CTTCAGTTACACACGAAGAAA pLKO_005 1122 CDS 100% 5.625 3.938 N Abca3 n/a
9 TRCN0000113385 GCGTCCTCTCCCTCCCAGTTT pLKO.1 5830 3UTR 100% 0.000 0.000 N Abca3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524370.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15350 pDONR223 0% 10.2% 10.6% None (many diffs) n/a
2 ccsbBroad304_15350 pLX_304 0% 10.2% 10.6% V5 (many diffs) n/a
3 TRCN0000478249 CCTCCTGACCTGCCACTAAATTGA pLX_317 47.1% 10.2% 10.6% V5 (many diffs) n/a
Download CSV