Transcript: Mouse XM_006524654.3

PREDICTED: Mus musculus atlastin GTPase 2 (Atl2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atl2 (56298)
Length:
4143
CDS:
93..1847

Additional Resources:

NCBI RefSeq record:
XM_006524654.3
NBCI Gene record:
Atl2 (56298)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524654.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193302 CGGAACAATGATTGATCAGAT pLKO.1 1682 CDS 100% 4.950 3.960 N Atl2 n/a
2 TRCN0000217611 GATAGCCAGTCAACCATTAAA pLKO.1 627 CDS 100% 15.000 10.500 N Atl2 n/a
3 TRCN0000174364 CAGTCATGTTTGCTATGTATA pLKO.1 1531 CDS 100% 13.200 9.240 N Atl2 n/a
4 TRCN0000150557 GAGACTGTCATCCAACAATAA pLKO.1 1811 CDS 100% 13.200 9.240 N ATL2 n/a
5 TRCN0000174774 GAAATCGGAACAATGATTGAT pLKO.1 1677 CDS 100% 5.625 3.938 N Atl2 n/a
6 TRCN0000174658 GTTCAGAGAAATCGGAACAAT pLKO.1 1670 CDS 100% 5.625 3.938 N Atl2 n/a
7 TRCN0000152503 GCTTCGAAATCTGGTTCCATT pLKO.1 1061 CDS 100% 4.950 3.465 N ATL2 n/a
8 TRCN0000156840 GTGCCTTTGATAGCCAGTCAA pLKO.1 619 CDS 100% 4.950 3.465 N ATL2 n/a
9 TRCN0000174949 GCTGAAATCGAAGAAACCTAT pLKO.1 1440 CDS 100% 4.950 2.970 N Atl2 n/a
10 TRCN0000152894 GACCAGCTTGAAGCTGAAATT pLKO.1 1428 CDS 100% 13.200 9.240 N ATL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524654.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12463 pDONR223 100% 60.5% 64% None (many diffs) n/a
2 ccsbBroad304_12463 pLX_304 0% 60.5% 64% V5 (many diffs) n/a
3 TRCN0000471728 TGTGATCACACCCGAAAGTGGTTC pLX_317 24.8% 60.5% 64% V5 (many diffs) n/a
Download CSV