Transcript: Mouse XM_006524859.1

PREDICTED: Mus musculus WAS protein family homolog 1 (Wash1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Washc1 (68767)
Length:
1993
CDS:
252..1679

Additional Resources:

NCBI RefSeq record:
XM_006524859.1
NBCI Gene record:
Washc1 (68767)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346591 ACCACAGAGAATCTGTATAAG pLKO_005 783 CDS 100% 13.200 9.240 N Washc1 n/a
2 TRCN0000346518 CCATCCTACCTACCCGATTTA pLKO_005 987 CDS 100% 13.200 9.240 N Washc1 n/a
3 TRCN0000346590 CCTGATGTACAGTGCGGATTT pLKO_005 1025 CDS 100% 10.800 7.560 N Washc1 n/a
4 TRCN0000245682 AGACATCTTCAGCAGGATCTC pLKO_005 386 CDS 100% 4.050 2.835 N WASH5P n/a
5 TRCN0000346517 CAAGCCAACAGTGGCCTTTAA pLKO_005 1935 3UTR 100% 13.200 7.920 N Washc1 n/a
6 TRCN0000346592 TCTGCAGGAGAAGCTGAAATA pLKO_005 653 CDS 100% 13.200 7.920 N Washc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13628 pDONR223 100% 81.1% 84.4% None (many diffs) n/a
2 ccsbBroad304_13628 pLX_304 0% 81.1% 84.4% V5 (many diffs) n/a
3 TRCN0000468550 ACATGGAGTCAGTTCTTTTTGGCA pLX_317 30.2% 81.1% 84.4% V5 (many diffs) n/a
Download CSV