Transcript: Mouse XM_006524991.3

PREDICTED: Mus musculus alpha tubulin acetyltransferase 1 (Atat1), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atat1 (73242)
Length:
750
CDS:
47..697

Additional Resources:

NCBI RefSeq record:
XM_006524991.3
NBCI Gene record:
Atat1 (73242)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524991.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174864 GTGAACAACTTTGTCATCTTT pLKO.1 584 CDS 100% 5.625 3.938 N Atat1 n/a
2 TRCN0000194424 CCCACAGGTGAACAACTTTGT pLKO.1 577 CDS 100% 4.950 3.465 N Atat1 n/a
3 TRCN0000175685 GCAGCAGCAAATCATGACTAT pLKO.1 163 CDS 100% 4.950 3.465 N Atat1 n/a
4 TRCN0000193455 GTTCCTGAATAAGCACTACAA pLKO.1 541 CDS 100% 4.950 3.465 N Atat1 n/a
5 TRCN0000172948 GAAGGCTTCTTTGCCCATCAA pLKO.1 605 CDS 100% 4.950 3.465 N ATAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524991.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10521 pDONR223 100% 51.3% 48.4% None (many diffs) n/a
2 ccsbBroad304_10521 pLX_304 0% 51.3% 48.4% V5 (many diffs) n/a
3 TRCN0000466770 CACCAGTATCGGGACTCGTTCTGC pLX_317 71.4% 51.3% 48.4% V5 (many diffs) n/a
Download CSV