Transcript: Mouse XM_006525526.2

PREDICTED: Mus musculus adaptor-related protein complex 3, sigma 1 subunit (Ap3s1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ap3s1 (11777)
Length:
2589
CDS:
133..621

Additional Resources:

NCBI RefSeq record:
XM_006525526.2
NBCI Gene record:
Ap3s1 (11777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525526.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382090 GACATTATGCAACACTATATT pLKO_005 329 CDS 100% 15.000 21.000 N Ap3s1 n/a
2 TRCN0000113166 CCGTGCTGTATCAGCTGTAAA pLKO.1 1890 3UTR 100% 13.200 18.480 N Ap3s1 n/a
3 TRCN0000113169 CGCGATGAGAACGTTTGTAAT pLKO.1 256 CDS 100% 13.200 18.480 N Ap3s1 n/a
4 TRCN0000309508 CGCGATGAGAACGTTTGTAAT pLKO_005 256 CDS 100% 13.200 18.480 N Ap3s1 n/a
5 TRCN0000379473 CATTGGTGACATCAGTATAAA pLKO_005 1947 3UTR 100% 15.000 10.500 N AP3S1 n/a
6 TRCN0000296527 CAAGTATTTGTGGAAACATTA pLKO_005 403 CDS 100% 13.200 9.240 N AP3S1 n/a
7 TRCN0000113168 CCATGTAGACAAGGTTCATAA pLKO.1 465 CDS 100% 13.200 9.240 N Ap3s1 n/a
8 TRCN0000309507 CCATGTAGACAAGGTTCATAA pLKO_005 465 CDS 100% 13.200 9.240 N Ap3s1 n/a
9 TRCN0000060316 CTTCCTGAGATCCCAAGAAAT pLKO.1 1921 3UTR 100% 13.200 9.240 N AP3S1 n/a
10 TRCN0000290032 CTTCCTGAGATCCCAAGAAAT pLKO_005 1921 3UTR 100% 13.200 9.240 N AP3S1 n/a
11 TRCN0000113167 GCTCTGACAACAAGCTCATTT pLKO.1 305 CDS 100% 13.200 9.240 N Ap3s1 n/a
12 TRCN0000309510 GCTCTGACAACAAGCTCATTT pLKO_005 305 CDS 100% 13.200 9.240 N Ap3s1 n/a
13 TRCN0000113165 CCAAGTATGTATTGCATGAAA pLKO.1 2418 3UTR 100% 5.625 3.938 N Ap3s1 n/a
14 TRCN0000309509 CCAAGTATGTATTGCATGAAA pLKO_005 2418 3UTR 100% 5.625 3.938 N Ap3s1 n/a
15 TRCN0000296526 GATCTAATTCAAGTATTTGTG pLKO_005 394 CDS 100% 4.950 3.465 N AP3S1 n/a
16 TRCN0000060317 GTAATTTCCTAGAAGGAGGAT pLKO.1 272 CDS 100% 2.640 1.848 N AP3S1 n/a
17 TRCN0000060314 GCAAATCATCAGGGAGACTTT pLKO.1 219 CDS 100% 4.950 2.970 N AP3S1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525526.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00320 pDONR223 100% 77.5% 78.7% None (many diffs) n/a
2 ccsbBroad304_00320 pLX_304 0% 77.5% 78.7% V5 (many diffs) n/a
3 TRCN0000474919 TGCGCCCAAACAGCAAGTCATGCG pLX_317 69.4% 77.5% 78.7% V5 (many diffs) n/a
Download CSV