Transcript: Mouse XM_006525585.3

PREDICTED: Mus musculus colony stimulating factor 1 receptor (Csf1r), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Csf1r (12978)
Length:
3770
CDS:
179..3112

Additional Resources:

NCBI RefSeq record:
XM_006525585.3
NBCI Gene record:
Csf1r (12978)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525585.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023659 GCCTGTATTTGCACCGAAGAA pLKO.1 2803 CDS 100% 4.950 6.930 N Csf1r n/a
2 TRCN0000023660 GCTCTTTCTGAACCGTGTAAA pLKO.1 1267 CDS 100% 13.200 10.560 N Csf1r n/a
3 TRCN0000321848 GCTCTTTCTGAACCGTGTAAA pLKO_005 1267 CDS 100% 13.200 10.560 N Csf1r n/a
4 TRCN0000023662 CCATGGTGAATGGTAGGGAAT pLKO.1 714 CDS 100% 4.050 3.240 N Csf1r n/a
5 TRCN0000321847 CCATGGTGAATGGTAGGGAAT pLKO_005 714 CDS 100% 4.050 3.240 N Csf1r n/a
6 TRCN0000321788 TCAATGGAAAGACTGATTTAT pLKO_005 3412 3UTR 100% 15.000 10.500 N Csf1r n/a
7 TRCN0000321787 TCCAAGACGCTGGCATATATT pLKO_005 987 CDS 100% 15.000 10.500 N Csf1r n/a
8 TRCN0000023661 CCTACTCAGTTGCCCTACAAT pLKO.1 1868 CDS 100% 5.625 3.938 N Csf1r n/a
9 TRCN0000321849 CCTACTCAGTTGCCCTACAAT pLKO_005 1868 CDS 100% 5.625 3.938 N Csf1r n/a
10 TRCN0000023663 CGAGAATATAGTCAACCTCTT pLKO.1 2101 CDS 100% 4.050 2.835 N Csf1r n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525585.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488556 ATGCCATGCATACCCGAGTTCCTT pLX_317 27.2% 37.7% 1.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV