Transcript: Mouse XM_006525745.2

PREDICTED: Mus musculus microtubule-associated protein, RP/EB family, member 2 (Mapre2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mapre2 (212307)
Length:
3748
CDS:
1..822

Additional Resources:

NCBI RefSeq record:
XM_006525745.2
NBCI Gene record:
Mapre2 (212307)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306397 TGACCTCGTGCAGCGACTAAT pLKO_005 699 CDS 100% 13.200 18.480 N Mapre2 n/a
2 TRCN0000306398 AGGATAACGGGACTATCATTC pLKO_005 28 CDS 100% 10.800 15.120 N Mapre2 n/a
3 TRCN0000088125 CGATGCTAACTATGACGGGAA pLKO.1 312 CDS 100% 2.160 3.024 N Mapre2 n/a
4 TRCN0000088127 GCATCCTTTAAACGGATGAAT pLKO.1 205 CDS 100% 0.563 0.450 N Mapre2 n/a
5 TRCN0000337596 GTCTAACCTCCTCTCATAAAT pLKO_005 1265 3UTR 100% 15.000 10.500 N Mapre2 n/a
6 TRCN0000337597 CAAAGTTGGAGCATGAGTATA pLKO_005 161 CDS 100% 13.200 9.240 N Mapre2 n/a
7 TRCN0000311535 CAGTAGCTGTCACGCGCATTT pLKO_005 1223 3UTR 100% 10.800 7.560 N Mapre2 n/a
8 TRCN0000088123 CCCATCTTAAATACCTTGAAA pLKO.1 2989 3UTR 100% 5.625 3.938 N Mapre2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02587 pDONR223 100% 75.6% 72.8% None (many diffs) n/a
2 ccsbBroad304_02587 pLX_304 0% 75.6% 72.8% V5 (many diffs) n/a
3 TRCN0000467311 AAACTTTGATACGATTGTACTTTT pLX_317 32.8% 75.6% 72.8% V5 (many diffs) n/a
Download CSV