Transcript: Mouse XM_006525769.2

PREDICTED: Mus musculus zinc finger E-box binding homeobox 1 (Zeb1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zeb1 (21417)
Length:
6930
CDS:
1753..5085

Additional Resources:

NCBI RefSeq record:
XM_006525769.2
NBCI Gene record:
Zeb1 (21417)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235852 GAACCTCAAACCTAGTAATTT pLKO_005 5241 3UTR 100% 15.000 21.000 N Zeb1 n/a
2 TRCN0000235853 GTCGACAGTCAGTAGCGTTTA pLKO_005 3912 CDS 100% 10.800 15.120 N Zeb1 n/a
3 TRCN0000070822 CCGGGTCAGTAAACATACCTA pLKO.1 3611 CDS 100% 3.000 4.200 N Zeb1 n/a
4 TRCN0000235854 ACAAGACACCGCCGTCATTTA pLKO_005 2067 CDS 100% 13.200 9.240 N Zeb1 n/a
5 TRCN0000235850 ATAGAGGCTACAAGCGCTTTA pLKO_005 2198 CDS 100% 10.800 7.560 N Zeb1 n/a
6 TRCN0000235851 CCGCCAACAAGCAGACTATTC pLKO_005 4154 CDS 100% 10.800 7.560 N Zeb1 n/a
7 TRCN0000070818 CCTGTGGATTATGAGTTCAAA pLKO.1 2719 CDS 100% 5.625 3.938 N Zeb1 n/a
8 TRCN0000070821 CCGAACTGCAAGAAACGGTTT pLKO.1 2482 CDS 100% 4.050 2.835 N Zeb1 n/a
9 TRCN0000070819 GCATCATTTGATTGAGCACAT pLKO.1 4497 CDS 100% 4.050 2.835 N Zeb1 n/a
10 TRCN0000070820 CCATAAACATTGCTATTCCTA pLKO.1 4061 CDS 100% 3.000 2.100 N Zeb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13965 pDONR223 100% 82.1% 56.3% None (many diffs) n/a
2 ccsbBroad304_13965 pLX_304 0% 82.1% 56.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477158 CCCGCTCATGGGATCTCCAACAGT pLX_317 10.6% 82.1% 56.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV