Transcript: Mouse XM_006525810.2

PREDICTED: Mus musculus mindbomb E3 ubiquitin protein ligase 1 (Mib1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mib1 (225164)
Length:
4564
CDS:
753..3773

Additional Resources:

NCBI RefSeq record:
XM_006525810.2
NBCI Gene record:
Mib1 (225164)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041020 GCTGACCTGAATGCTCGTAAT pLKO.1 2313 CDS 100% 10.800 15.120 N Mib1 n/a
2 TRCN0000041021 CCTTCTATGATTAGCAACGAT pLKO.1 3168 CDS 100% 3.000 4.200 N Mib1 n/a
3 TRCN0000041018 CGGATGAGTGAATGCCCAATT pLKO.1 3714 CDS 100% 10.800 8.640 N Mib1 n/a
4 TRCN0000041022 CGATGGCATGTTTGAGACTTT pLKO.1 1568 CDS 100% 4.950 3.960 N Mib1 n/a
5 TRCN0000004557 GCCGAGTACAACAGATTTATT pLKO.1 1861 CDS 100% 15.000 10.500 N MIB1 n/a
6 TRCN0000342502 GCCGAGTACAACAGATTTATT pLKO_005 1861 CDS 100% 15.000 10.500 N MIB1 n/a
7 TRCN0000041019 GCCATAAGTAAGAAACGGGAT pLKO.1 2460 CDS 100% 2.160 1.512 N Mib1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.