Transcript: Mouse XM_006526011.3

PREDICTED: Mus musculus actin binding LIM protein family, member 3 (Ablim3), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ablim3 (319713)
Length:
4237
CDS:
619..2334

Additional Resources:

NCBI RefSeq record:
XM_006526011.3
NBCI Gene record:
Ablim3 (319713)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526011.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099548 GCGGACATCTGAAACTTCCAT pLKO.1 1440 CDS 100% 3.000 4.200 N Ablim3 n/a
2 TRCN0000099545 CGCAGTATAATCCTCTTGTAT pLKO.1 2397 3UTR 100% 5.625 4.500 N Ablim3 n/a
3 TRCN0000099549 CTGGAAGAGGAACGAACTGAA pLKO.1 2292 CDS 100% 4.950 3.465 N Ablim3 n/a
4 TRCN0000099546 GCCTTTCCCTATTGGAGATAA pLKO.1 957 CDS 100% 13.200 7.920 N Ablim3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526011.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11642 pDONR223 100% 86% 92.1% None (many diffs) n/a
2 ccsbBroad304_11642 pLX_304 0% 86% 92.1% V5 (many diffs) n/a
3 TRCN0000470912 TGAACTTAATCGTAGTCTGGCAAC pLX_317 16.5% 86% 92.1% V5 (many diffs) n/a
Download CSV