Transcript: Mouse XM_006526123.2

PREDICTED: Mus musculus ring finger protein 14 (Rnf14), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf14 (56736)
Length:
3116
CDS:
419..1876

Additional Resources:

NCBI RefSeq record:
XM_006526123.2
NBCI Gene record:
Rnf14 (56736)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526123.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037355 GCAGTCTACCTTGGATCTAAT pLKO.1 1309 CDS 100% 13.200 10.560 N Rnf14 n/a
2 TRCN0000037354 CGTGGATATTAATGGTGATAT pLKO.1 1801 CDS 100% 13.200 9.240 N Rnf14 n/a
3 TRCN0000037357 GCACTGGCTGTATGCAGTATT pLKO.1 1686 CDS 100% 13.200 9.240 N Rnf14 n/a
4 TRCN0000003443 CCACCTTCATTCACACTTAGT pLKO.1 680 CDS 100% 4.950 3.465 N RNF14 n/a
5 TRCN0000037358 CCACCACTTGTGCTGAACTTT pLKO.1 629 CDS 100% 5.625 3.375 N Rnf14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526123.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02209 pDONR223 100% 86.1% 88.4% None (many diffs) n/a
2 ccsbBroad304_02209 pLX_304 0% 86.1% 88.4% V5 (many diffs) n/a
3 TRCN0000469427 TGAAGGTAACCAAAGAAGTGTCGC pLX_317 27.4% 86.1% 88.4% V5 (many diffs) n/a
Download CSV