Construct: ORF TRCN0000469427
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018286.1_s317c1
- Derived from:
- ccsbBroadEn_02209
- DNA Barcode:
- TGAAGGTAACCAAAGAAGTGTCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RNF14 (9604)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469427
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9604 | RNF14 | ring finger protein 14 | NM_001201365.1 | 100% | 100% | |
| 2 | human | 9604 | RNF14 | ring finger protein 14 | NM_004290.5 | 100% | 100% | |
| 3 | human | 9604 | RNF14 | ring finger protein 14 | NM_183399.2 | 100% | 100% | |
| 4 | human | 9604 | RNF14 | ring finger protein 14 | NM_183400.2 | 100% | 100% | |
| 5 | human | 9604 | RNF14 | ring finger protein 14 | NM_183401.3 | 100% | 100% | |
| 6 | human | 9604 | RNF14 | ring finger protein 14 | XM_011537714.3 | 100% | 100% | |
| 7 | human | 9604 | RNF14 | ring finger protein 14 | NM_183398.3 | 73.4% | 73.4% | 0_1ins378 |
| 8 | human | 9604 | RNF14 | ring finger protein 14 | XM_005268539.3 | 73.4% | 73.4% | 0_1ins378 |
| 9 | human | 9604 | RNF14 | ring finger protein 14 | XM_005268540.4 | 73.4% | 73.4% | 0_1ins378 |
| 10 | human | 9604 | RNF14 | ring finger protein 14 | XM_005268541.4 | 73.4% | 73.4% | 0_1ins378 |
| 11 | human | 9604 | RNF14 | ring finger protein 14 | XM_017010071.2 | 73.4% | 73.4% | 0_1ins378 |
| 12 | human | 9604 | RNF14 | ring finger protein 14 | XM_017010072.2 | 73.4% | 73.4% | 0_1ins378 |
| 13 | human | 9604 | RNF14 | ring finger protein 14 | XM_005268542.3 | 62.8% | 62.8% | 302_303ins528 |
| 14 | human | 9604 | RNF14 | ring finger protein 14 | XM_005268543.5 | 62.8% | 62.8% | 302_303ins528 |
| 15 | human | 9604 | RNF14 | ring finger protein 14 | XM_017010073.2 | 62.8% | 62.8% | 302_303ins528 |
| 16 | human | 9604 | RNF14 | ring finger protein 14 | XM_017010074.2 | 62.8% | 62.8% | 302_303ins528 |
| 17 | human | 9604 | RNF14 | ring finger protein 14 | XM_017010075.2 | 62.8% | 62.8% | 302_303ins528 |
| 18 | human | 9604 | RNF14 | ring finger protein 14 | XM_024446265.1 | 62.8% | 62.8% | 302_303ins528 |
| 19 | mouse | 56736 | Rnf14 | ring finger protein 14 | NM_001164621.1 | 86.1% | 88.4% | (many diffs) |
| 20 | mouse | 56736 | Rnf14 | ring finger protein 14 | NM_020012.2 | 86.1% | 88.4% | (many diffs) |
| 21 | mouse | 56736 | Rnf14 | ring finger protein 14 | XM_006526121.2 | 86.1% | 88.4% | (many diffs) |
| 22 | mouse | 56736 | Rnf14 | ring finger protein 14 | XM_006526122.2 | 86.1% | 88.4% | (many diffs) |
| 23 | mouse | 56736 | Rnf14 | ring finger protein 14 | XM_006526123.2 | 86.1% | 88.4% | (many diffs) |
| 24 | mouse | 56736 | Rnf14 | ring finger protein 14 | XM_006526124.2 | 86.1% | 88.4% | (many diffs) |
| 25 | mouse | 56736 | Rnf14 | ring finger protein 14 | XM_006526125.2 | 86.1% | 88.4% | (many diffs) |
| 26 | mouse | 56736 | Rnf14 | ring finger protein 14 | XM_006526126.1 | 86.1% | 88.4% | (many diffs) |
| 27 | mouse | 56736 | Rnf14 | ring finger protein 14 | XM_006526127.2 | 86.1% | 88.4% | (many diffs) |
| 28 | mouse | 56736 | Rnf14 | ring finger protein 14 | XM_017317955.1 | 86.1% | 88.4% | (many diffs) |
| 29 | mouse | 56736 | Rnf14 | ring finger protein 14 | XM_017317956.1 | 86.1% | 88.4% | (many diffs) |
| 30 | mouse | 56736 | Rnf14 | ring finger protein 14 | XM_017317957.1 | 86.1% | 88.4% | (many diffs) |
| 31 | mouse | 56736 | Rnf14 | ring finger protein 14 | NM_001164622.1 | 61.9% | 63.5% | (many diffs) |
| 32 | mouse | 56736 | Rnf14 | ring finger protein 14 | XM_006526128.1 | 61.9% | 63.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1491
- ORF length:
- 1422
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcgtcagaa gatcgagaag ctcaggagga tgaattgctg gccctggcaa 121 gtatttacga tggagatgaa tttagaaaag cagagtctgt ccaaggtgga gaaaccagga 181 tctatttgga tttgccacag aatttcaaga tatttgtgag cggcaattca aatgagtgtc 241 tccagaatag tggctttgaa tacaccattt gctttctgcc tccacttgtg ctgaactttg 301 aactgccacc agattatcca tcctcttccc caccttcatt cacacttagt ggcaaatggc 361 tgtcaccaac tcagctatct gctctatgca agcacttaga caacctatgg gaagaacacc 421 gtggcagcgt ggtcctgttt gcctggatgc aatttcttaa ggaagagacc ctagcatact 481 tgaatattgt ctctcctttt gagctcaaga ttggttctca gaaaaaagtg cagagaagga 541 cagctcaagc ttctcccaac acagagctag attttggagg agctgctgga tctgatgtag 601 accaagagga aattgtggat gagagagcag tgcaggatgt ggaatcactg tcaaatctga 661 tccaggaaat cttggacttt gatcaagctc agcagataaa atgctttaat agtaaattgt 721 tcctgtgcag tatctgtttc tgtgagaagc tgggtagtga atgcatgtac ttcttggagt 781 gcaggcatgt gtactgcaaa gcctgtctga aggactactt tgaaatccag atcagagatg 841 gccaggttca atgcctcaac tgcccagaac caaagtgccc ttcggtggcc actcctggtc 901 aggtcaaaga gttagtggaa gcagagttat ttgcccgtta tgaccgcctt ctcctccagt 961 cctccttgga cctgatggca gatgtggtgt actgcccccg gccgtgctgc cagctgcctg 1021 tgatgcagga acctggctgc accatgggta tctgctccag ctgcaatttt gccttctgta 1081 ctttgtgcag gttgacctac catggGGTCT CCCCATGTAA GGTGACTGCA GAGAAATTAA 1141 TGGACTTACG AAATGAATAC CTGCAAGCGG ATGAGGCTAA TAAAAGACTT TTGGATCAAA 1201 GGTATGGTAA GAGAGTGATT CAGAAGGCAC TGGAAGAGAT GGAAAGTAAG GAGTGGCTAG 1261 AGAAGAACTC AAAGAGCTGC CCATGTTGTG GAACTCCCAT AGAGAAATTA GACGGATGTA 1321 ACAAGATGAC ATGTACTGGC TGTATGCAAT ATTTCTGTTG GATTTGCATG GGTTCTCTCT 1381 CTAGAGCAAA CCCTTACAAA CATTTCAATG ACCCTGGTTC ACCATGTTTT AACCGGCTGT 1441 TTTATGCTGT GGATGTTGAC GACGATATTT GGGAAGATGA GGTAGAAGAC TTGCCAACTT 1501 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1561 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1621 CTTGTGGAAA GGACGATGAA GGTAACCAAA GAAGTGTCGC ACGCGTTAAG TCgacaatca 1681 acctctggat tacaaaattt gtgaaagatt