Transcript: Mouse XM_006526154.3

PREDICTED: Mus musculus family with sequence similarity 53, member C (Fam53c), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam53c (66306)
Length:
4268
CDS:
296..1366

Additional Resources:

NCBI RefSeq record:
XM_006526154.3
NBCI Gene record:
Fam53c (66306)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526154.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193779 CTGGACCTGAATCTGATTGAA pLKO.1 1337 CDS 100% 5.625 3.938 N Fam53c n/a
2 TRCN0000194135 GCAGCCTATGTTTGCTTCTTT pLKO.1 3803 3UTR 100% 5.625 3.938 N Fam53c n/a
3 TRCN0000174004 CAAGAAACAGCCCGAGAAGAA pLKO.1 1133 CDS 100% 4.950 3.465 N Fam53c n/a
4 TRCN0000193088 CTTTGACAAGATGAATCAGAA pLKO.1 1087 CDS 100% 4.950 3.465 N Fam53c n/a
5 TRCN0000174010 GCCTTCCTTGGACTTTGACAA pLKO.1 1075 CDS 100% 4.950 3.465 N Fam53c n/a
6 TRCN0000139906 GAAACCATACTCAGGAGGTCT pLKO.1 1105 CDS 100% 2.640 1.848 N FAM53C n/a
7 TRCN0000216128 CCACTAGATGAATCTAGTATT pLKO.1 2264 3UTR 100% 1.320 0.924 N Fam53c n/a
8 TRCN0000121786 CAAGATGAATCAGAAACCATA pLKO.1 1093 CDS 100% 4.950 2.970 N FAM53C n/a
9 TRCN0000280975 CAAGATGAATCAGAAACCATA pLKO_005 1093 CDS 100% 4.950 2.970 N FAM53C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526154.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03278 pDONR223 100% 84.1% 84.4% None (many diffs) n/a
2 ccsbBroad304_03278 pLX_304 0% 84.1% 84.4% V5 (many diffs) n/a
3 TRCN0000473319 GGGCTCAACACTTCGCTGTGCTGT pLX_317 37.5% 84.1% 84.4% V5 (many diffs) n/a
Download CSV