Transcript: Mouse XM_006526188.3

PREDICTED: Mus musculus ring finger protein 125 (Rnf125), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf125 (67664)
Length:
5387
CDS:
512..1213

Additional Resources:

NCBI RefSeq record:
XM_006526188.3
NBCI Gene record:
Rnf125 (67664)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526188.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106403 GCACATAAGGACCTGTGAGAA pLKO.1 856 CDS 100% 4.950 6.930 N Rnf125 n/a
2 TRCN0000106400 GCCCTTACATTCTTGAGTCTA pLKO.1 1377 3UTR 100% 4.950 6.930 N Rnf125 n/a
3 TRCN0000106404 AGTACCTTCAATGGCAGTTTA pLKO.1 1058 CDS 100% 13.200 10.560 N Rnf125 n/a
4 TRCN0000106402 GCAAGATGTGTATGTCCATTT pLKO.1 923 CDS 100% 10.800 7.560 N Rnf125 n/a
5 TRCN0000106401 GCCATTCACGACCTGATGAAA pLKO.1 1032 CDS 100% 5.625 3.938 N Rnf125 n/a
6 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 1971 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526188.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467387 TTTAAGAATTCTATTTCCAAAATG pLX_317 66.2% 84% 85.4% V5 (many diffs) n/a
2 ccsbBroadEn_14177 pDONR223 99.5% 83.7% 84.9% None (many diffs) n/a
3 ccsbBroad304_14177 pLX_304 0% 83.7% 84.9% V5 (many diffs) n/a
Download CSV