Transcript: Mouse XM_006526224.3

PREDICTED: Mus musculus COMM domain containing 10 (Commd10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Commd10 (69456)
Length:
1738
CDS:
106..870

Additional Resources:

NCBI RefSeq record:
XM_006526224.3
NBCI Gene record:
Commd10 (69456)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526224.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183397 GCTGTTCGATTTCTACAACAA pLKO.1 749 CDS 100% 4.950 6.930 N Commd10 n/a
2 TRCN0000183572 GCATTCTCTCTAGAGAAACAA pLKO.1 283 CDS 100% 0.563 0.788 N Commd10 n/a
3 TRCN0000183675 CTGGAGACAATATCATTTGTT pLKO.1 319 CDS 100% 5.625 3.938 N Commd10 n/a
4 TRCN0000168445 GAGAGCAGTTTCAGTGAAGAA pLKO.1 241 CDS 100% 4.950 3.465 N COMMD10 n/a
5 TRCN0000280882 GAGAGCAGTTTCAGTGAAGAA pLKO_005 241 CDS 100% 4.950 3.465 N COMMD10 n/a
6 TRCN0000183119 CGCTGATAAATGCAATAGACA pLKO.1 164 CDS 100% 3.000 2.100 N Commd10 n/a
7 TRCN0000178868 CTTAGGAAAGACAAAGCGGAA pLKO.1 406 CDS 100% 2.160 1.512 N Commd10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526224.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08286 pDONR223 100% 67.9% 55.8% None (many diffs) n/a
2 ccsbBroad304_08286 pLX_304 0% 67.9% 55.8% V5 (many diffs) n/a
3 TRCN0000475125 TGGCCTCAAACAAGCTGAAAATGT pLX_317 70.9% 67.9% 55.8% V5 (many diffs) n/a
Download CSV