Transcript: Mouse XM_006526289.2

PREDICTED: Mus musculus proline-rich coiled-coil 1 (Prrc1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prrc1 (73137)
Length:
4985
CDS:
127..1458

Additional Resources:

NCBI RefSeq record:
XM_006526289.2
NBCI Gene record:
Prrc1 (73137)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217038 CTGATTCGCTCATCGTTATTT pLKO.1 4578 3UTR 100% 15.000 21.000 N Prrc1 n/a
2 TRCN0000184453 GACTACAATCTGAGGTGGTCA pLKO.1 1270 CDS 100% 2.640 3.696 N Prrc1 n/a
3 TRCN0000250402 GCTCGTTTGAAACCGAATAAT pLKO_005 3802 3UTR 100% 15.000 10.500 N Prrc1 n/a
4 TRCN0000250401 TCCTGGCATGGCTCCATATAT pLKO_005 855 CDS 100% 15.000 10.500 N Prrc1 n/a
5 TRCN0000250400 CTGGAGGTGAACTGGATATTG pLKO_005 881 CDS 100% 13.200 9.240 N Prrc1 n/a
6 TRCN0000364921 CTGGAGGTGAACTGGATATTG pLKO_005 881 CDS 100% 13.200 9.240 N PRRC1 n/a
7 TRCN0000258062 GGAAGCTGGACAGTCCAATAT pLKO_005 984 CDS 100% 13.200 9.240 N Prrc1 n/a
8 TRCN0000364922 GGAAGCTGGACAGTCCAATAT pLKO_005 984 CDS 100% 13.200 9.240 N PRRC1 n/a
9 TRCN0000250403 ACCACATCAGCCATTACTTTC pLKO_005 676 CDS 100% 10.800 7.560 N Prrc1 n/a
10 TRCN0000369805 ACCACATCAGCCATTACTTTC pLKO_005 676 CDS 100% 10.800 7.560 N PRRC1 n/a
11 TRCN0000184253 GCCTGACAAGTGGTTTGACAT pLKO.1 1137 CDS 100% 4.950 3.465 N Prrc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10476 pDONR223 100% 80.9% 87.1% None (many diffs) n/a
2 ccsbBroad304_10476 pLX_304 0% 80.9% 87.1% V5 (many diffs) n/a
3 TRCN0000470818 GATCGAAGCCCTATTGCATAAACA pLX_317 29.5% 80.9% 87.1% V5 (many diffs) n/a
Download CSV