Transcript: Mouse XM_006526353.3

PREDICTED: Mus musculus establishment of sister chromatid cohesion N-acetyltransferase 1 (Esco1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Esco1 (77805)
Length:
2423
CDS:
397..1431

Additional Resources:

NCBI RefSeq record:
XM_006526353.3
NBCI Gene record:
Esco1 (77805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526353.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243424 CAATGCAGTAATAGCTTATTA pLKO_005 1581 3UTR 100% 15.000 21.000 N Esco1 n/a
2 TRCN0000243425 AGATAGCTTCTCGCATGATTG pLKO_005 1253 CDS 100% 10.800 15.120 N Esco1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526353.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09400 pDONR223 100% 35.3% 34.9% None (many diffs) n/a
2 ccsbBroad304_09400 pLX_304 0% 35.3% 34.9% V5 (many diffs) n/a
3 TRCN0000475578 TGAAAGCATAGCTTTGTCTAAATC pLX_317 11% 35.3% 34.9% V5 (many diffs) n/a
Download CSV