Transcript: Mouse XM_006526365.3

PREDICTED: Mus musculus endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae) (Sil1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sil1 (81500)
Length:
1873
CDS:
319..1716

Additional Resources:

NCBI RefSeq record:
XM_006526365.3
NBCI Gene record:
Sil1 (81500)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526365.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248656 GATTATGGTTCGGCTGATAAA pLKO_005 879 CDS 100% 13.200 18.480 N Sil1 n/a
2 TRCN0000248659 GGCCTTCAAGTGGTGATTAAT pLKO_005 1009 CDS 100% 15.000 12.000 N Sil1 n/a
3 TRCN0000248660 CAAGAGTGCGCTGGCCAAATT pLKO_005 723 CDS 100% 13.200 10.560 N Sil1 n/a
4 TRCN0000191112 GATCTTGAGTACTATGTCCAT pLKO.1 952 CDS 100% 2.640 2.112 N Sil1 n/a
5 TRCN0000248658 CAGCTGTCAGAACTCAAATAA pLKO_005 408 CDS 100% 15.000 10.500 N Sil1 n/a
6 TRCN0000248657 AGAAGGTTGCTGCGCTCTTTG pLKO_005 932 CDS 100% 10.800 7.560 N Sil1 n/a
7 TRCN0000201148 CCACCAGGAATCAGATACAAA pLKO.1 459 CDS 100% 5.625 3.938 N Sil1 n/a
8 TRCN0000190620 GCAGATTATGGTTCGGCTGAT pLKO.1 876 CDS 100% 4.050 2.835 N Sil1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526365.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000475039 AAGGTGCCAGCCCGGTGTACCTTT pLX_317 1.1% 84.2% 83% V5 (many diffs) n/a
Download CSV