Transcript: Mouse XM_006526452.3

PREDICTED: Mus musculus myelin basic protein (Mbp), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mbp (17196)
Length:
2830
CDS:
297..1349

Additional Resources:

NCBI RefSeq record:
XM_006526452.3
NBCI Gene record:
Mbp (17196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526452.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375538 ACCCTCACAGCGATCCAAGTA pLKO_005 713 CDS 100% 4.950 3.960 N Mbp n/a
2 TRCN0000090246 GACGAGCTTCAGACCATCCAA pLKO.1 639 CDS 100% 3.000 2.400 N Mbp n/a
3 TRCN0000090247 ACAGCAAGTACCATGGACCAT pLKO.1 741 CDS 100% 2.640 2.112 N Mbp n/a
4 TRCN0000376797 CAGATGCGATCCAGAACAATG pLKO_005 442 CDS 100% 10.800 7.560 N Mbp n/a
5 TRCN0000375536 GGGAGGACAACACCTTCAAAG pLKO_005 601 CDS 100% 10.800 7.560 N Mbp n/a
6 TRCN0000090244 GACCCAAAGAATAACTGGCAA pLKO.1 510 CDS 100% 2.640 1.848 N Mbp n/a
7 TRCN0000090245 GCCAGTAAGGATGGAGAGATT pLKO.1 339 CDS 100% 4.950 2.970 N Mbp n/a
8 TRCN0000116261 CCTGGCCACAGCAAGTACCAT pLKO.1 734 CDS 100% 1.000 0.600 N MBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526452.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00981 pDONR223 100% 48.6% 46% None (many diffs) n/a
2 ccsbBroad304_00981 pLX_304 0% 48.6% 46% V5 (many diffs) n/a
3 TRCN0000481619 TTCGGATGTTAAATAACATACGCA pLX_317 75.9% 48.6% 46% V5 (many diffs) n/a
Download CSV