Transcript: Mouse XM_006526678.2

PREDICTED: Mus musculus alpha glucosidase 2 alpha neutral subunit (Ganab), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ganab (14376)
Length:
4018
CDS:
537..3080

Additional Resources:

NCBI RefSeq record:
XM_006526678.2
NBCI Gene record:
Ganab (14376)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526678.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111288 GCACTCCTTATTCACCCTGTA pLKO.1 2496 CDS 100% 4.050 5.670 N Ganab n/a
2 TRCN0000309353 GCACTCCTTATTCACCCTGTA pLKO_005 2496 CDS 100% 4.050 5.670 N Ganab n/a
3 TRCN0000049579 GCGATATTCTTTGCTGCCCTT pLKO.1 2354 CDS 100% 2.160 3.024 N GANAB n/a
4 TRCN0000111289 GCTTTGACAATTATGAGGGTT pLKO.1 1822 CDS 100% 2.640 2.112 N Ganab n/a
5 TRCN0000111285 CCTAGATTTCACCTTCTAATT pLKO.1 3162 3UTR 100% 13.200 9.240 N Ganab n/a
6 TRCN0000309287 CCTAGATTTCACCTTCTAATT pLKO_005 3162 3UTR 100% 13.200 9.240 N Ganab n/a
7 TRCN0000111287 GCCACCTTGAGACACCTATTT pLKO.1 2887 CDS 100% 13.200 9.240 N Ganab n/a
8 TRCN0000309354 GCCACCTTGAGACACCTATTT pLKO_005 2887 CDS 100% 13.200 9.240 N Ganab n/a
9 TRCN0000049580 GCTGTGGATAGAAGCAACTTT pLKO.1 339 5UTR 100% 5.625 3.938 N GANAB n/a
10 TRCN0000286780 GCTGTGGATAGAAGCAACTTT pLKO_005 339 5UTR 100% 5.625 3.938 N GANAB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526678.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11692 pDONR223 100% 87.5% 91.6% None (many diffs) n/a
2 ccsbBroad304_11692 pLX_304 0% 87.5% 91.6% V5 (many diffs) n/a
3 TRCN0000476304 CCCGTTTACTTCCGCCCCATAGCC pLX_317 15.8% 87.5% 91.6% V5 (many diffs) n/a
Download CSV