Transcript: Mouse XM_006526680.1

PREDICTED: Mus musculus guanine deaminase (Gda), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gda (14544)
Length:
5334
CDS:
215..1453

Additional Resources:

NCBI RefSeq record:
XM_006526680.1
NBCI Gene record:
Gda (14544)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526680.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032822 CCGAAATATTGAGGAGGTTTA pLKO.1 1390 CDS 100% 10.800 15.120 N Gda n/a
2 TRCN0000454178 CCTTGGACATCTGCGACATTC pLKO_005 1457 3UTR 100% 10.800 8.640 N Gda n/a
3 TRCN0000032821 CCCTGATCCTTGCGGAAATTA pLKO.1 537 CDS 100% 15.000 10.500 N Gda n/a
4 TRCN0000032823 GTTTCCAATGTCCTCTTAATT pLKO.1 1133 CDS 100% 15.000 10.500 N Gda n/a
5 TRCN0000032819 GCTTGCTACTTTGGAACAATT pLKO.1 503 CDS 100% 13.200 9.240 N Gda n/a
6 TRCN0000032820 GCTGTTATCCAGAAGTTTCTT pLKO.1 1355 CDS 100% 5.625 3.938 N Gda n/a
7 TRCN0000046996 GTGATATTTCTGAGGCTGTTA pLKO.1 1341 CDS 100% 4.950 3.465 N GDA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526680.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02211 pDONR223 100% 79.5% 82.1% None (many diffs) n/a
2 ccsbBroad304_02211 pLX_304 0% 79.5% 82.1% V5 (many diffs) n/a
3 TRCN0000475326 AACGAAGATCTATTACCCAAATTC pLX_317 30.2% 79.5% 82.1% V5 (many diffs) n/a
Download CSV