Transcript: Mouse XM_006527052.2

PREDICTED: Mus musculus attractin like 1 (Atrnl1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atrnl1 (226255)
Length:
3959
CDS:
392..3742

Additional Resources:

NCBI RefSeq record:
XM_006527052.2
NBCI Gene record:
Atrnl1 (226255)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527052.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110936 CCGATGAATTATGGGTGTTTA pLKO.1 1533 CDS 100% 13.200 18.480 N Atrnl1 n/a
2 TRCN0000110938 CCTCTATAAGTACGAAGTCAA pLKO.1 1888 CDS 100% 4.950 3.960 N Atrnl1 n/a
3 TRCN0000110937 GCTATGATAATGCCAAACTTT pLKO.1 2691 CDS 100% 5.625 3.938 N Atrnl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527052.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15032 pDONR223 96.6% 36.8% 38.3% None (many diffs) n/a
2 ccsbBroad304_15032 pLX_304 0% 36.8% 38.3% V5 (many diffs) n/a
3 TRCN0000466299 GCGAATTAGCAAAAGAGCGTCGAG pLX_317 29.2% 36.8% 38.3% V5 (many diffs) n/a
Download CSV