Transcript: Mouse XM_006527439.3

PREDICTED: Mus musculus oxysterol binding protein (Osbp), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Osbp (76303)
Length:
4176
CDS:
493..2106

Additional Resources:

NCBI RefSeq record:
XM_006527439.3
NBCI Gene record:
Osbp (76303)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527439.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251257 TAAGATCCCAATGCCGGTAAA pLKO_005 978 CDS 100% 10.800 8.640 N Osbp n/a
2 TRCN0000251256 CCAGGGAGCTAACCCATATTT pLKO_005 2021 CDS 100% 15.000 10.500 N Osbp n/a
3 TRCN0000251260 CCTTGGTTGAGGGTCATAAAT pLKO_005 3628 3UTR 100% 15.000 10.500 N Osbp n/a
4 TRCN0000251258 GAGAACCAGAATACCATATAA pLKO_005 897 CDS 100% 15.000 10.500 N Osbp n/a
5 TRCN0000151689 CAACATTATTGTGGGCAAGTT pLKO.1 1431 CDS 100% 4.950 3.465 N OSBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527439.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14725 pDONR223 87.4% 60.5% 1.2% None (many diffs) n/a
2 ccsbBroad304_14725 pLX_304 0% 60.5% 1.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477852 GCTGCAAGAAGAAAACGAGCGTAA pLX_317 10% 60.4% 1.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV