Transcript: Mouse XM_006527442.3

PREDICTED: Mus musculus survival motor neuron domain containing 1 (Smndc1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smndc1 (76479)
Length:
2475
CDS:
804..1403

Additional Resources:

NCBI RefSeq record:
XM_006527442.3
NBCI Gene record:
Smndc1 (76479)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123794 GCCCAAGTATAGGTTAATTTA pLKO.1 1844 3UTR 100% 15.000 21.000 N Smndc1 n/a
2 TRCN0000123798 GCCAGGTAAAGAGGAGTATTT pLKO.1 1261 CDS 100% 13.200 9.240 N Smndc1 n/a
3 TRCN0000123795 GCGGAGATTGAAGAGATAGAT pLKO.1 960 CDS 100% 5.625 3.938 N Smndc1 n/a
4 TRCN0000123797 CCCATGACACAGTATCAAGAT pLKO.1 1344 CDS 100% 4.950 3.465 N Smndc1 n/a
5 TRCN0000123796 CCAAGTACAATGTCAGGCATT pLKO.1 1369 CDS 100% 4.050 2.835 N Smndc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02384 pDONR223 100% 75.4% 82.7% None (many diffs) n/a
2 ccsbBroad304_02384 pLX_304 0% 75.4% 82.7% V5 (many diffs) n/a
3 TRCN0000468163 CTCTGACGGGGTCTTTAGATCTCT pLX_317 54.7% 75.4% 82.7% V5 (many diffs) n/a
Download CSV