Transcript: Mouse XM_006527583.1

PREDICTED: Mus musculus tetraspanin 7 (Tspan7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tspan7 (21912)
Length:
1841
CDS:
158..859

Additional Resources:

NCBI RefSeq record:
XM_006527583.1
NBCI Gene record:
Tspan7 (21912)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094346 GTTAATCAGAAGGGCTGTTAT pLKO.1 695 CDS 100% 13.200 18.480 N Tspan7 n/a
2 TRCN0000327607 GTTAATCAGAAGGGCTGTTAT pLKO_005 695 CDS 100% 13.200 18.480 N Tspan7 n/a
3 TRCN0000094344 CCGTAGATATGCCGATGGTAA pLKO.1 1296 3UTR 100% 4.950 6.930 N Tspan7 n/a
4 TRCN0000327524 CCGTAGATATGCCGATGGTAA pLKO_005 1296 3UTR 100% 4.950 6.930 N Tspan7 n/a
5 TRCN0000094345 GCTGACTTTGGGAACCTATAT pLKO.1 232 CDS 100% 13.200 9.240 N Tspan7 n/a
6 TRCN0000327523 GCTGACTTTGGGAACCTATAT pLKO_005 232 CDS 100% 13.200 9.240 N Tspan7 n/a
7 TRCN0000094348 GATGCCATGCAGAACTACAAT pLKO.1 485 CDS 100% 5.625 3.938 N Tspan7 n/a
8 TRCN0000327606 GATGCCATGCAGAACTACAAT pLKO_005 485 CDS 100% 5.625 3.938 N Tspan7 n/a
9 TRCN0000094347 CATGCAGAACTACAATGGCAA pLKO.1 490 CDS 100% 2.640 1.848 N Tspan7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07076 pDONR223 100% 82.7% 85.7% None (many diffs) n/a
2 ccsbBroad304_07076 pLX_304 0% 82.7% 85.7% V5 (many diffs) n/a
3 TRCN0000470352 TCTGACGCTTAAGACCTGATTCCT pLX_317 57.4% 82.7% 85.7% V5 (many diffs) n/a
Download CSV